Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F54E12.5_b   

sjj_F54E12.5_bSequenceTAGACGACACTGACAAAGACGAA
In_sequenceF54E12
PCR_product sjj_F54E12.5
smd_F54E12.5