Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55A12.4   

sjj_F55A12.4RNAiJA:F55A12.4
PCR_productsjj_F55A12.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F55A12.4a Source_evidenceePCR845WS150 Sequence/Annotation Release
F55A12.4b Source_evidenceePCR744WS150 Sequence/Annotation Release
F55A12.4c Source_evidenceePCR805WS150 Sequence/Annotation Release
Overlaps_Gene F55A12.4 Source_evidenceePCR1370WS150 Sequence/Annotation Release
Chunk_score Abs_score1181
Max_abs_score1181F55A12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI53542195356466
Overlaps_transcript F55A12.4c Source_evidenceePCR805WS150 Sequence/Annotation Release
F55A12.4b Source_evidenceePCR1370WS150 Sequence/Annotation Release
F55A12.4a Source_evidenceePCR845WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55A12.42248aaacgtgactgataaagagccaggtacttaaaacaacagctccgatattcctaaacacaaaatactacacttccagtgttcaatttagacccgtattttctgtttttcaattataaaactatatcaaaatttcagatttccaatcacttgaaatgttaggtattctttattggattctgaacttaacggttgtggaatctgtattctatcttgttgtggcattcttgttatttttaattggcaggcactttattgagaagctccaaattaataatttatcgaaaagggccgtttttatcactggatgtgactctggtatatttttcggagcaacttacaaataactagatttgtctgttttgcaggattcggtcgtggattagcattaaaatgtttggagcaaggaatgcctgtatttgcaggatgtctcactgagcaggtatattatttgttatttattttttccgtcgggtcgagacctcgtaccgtaatcttcagttttgaattattaccagacgcgacatttagcgatttttgtgcaaaaaatcccagtctatgaaaattccacagctacgaaagtttgaaattacagtaatctataaagacgcacacatgtttctatataaaacaaaaatgcgtgtcgagaccgggtaccgtatttttcgcgtaaaaaatggaaaattttgtatctaactaatccagttttctttcttgttcctataattttgtttcgagttcaaaagttttcctaaaaatcccccacatcacataaaacatgaccgttgaatggtgccccatttcagggaatcgaaagtcttagtgcggaggctcgaaaatccatcggaaacgggcggtctctcgacgcgtttttgatggacgtgacaagtgacgagtctgtcggtgaagtggccaaacgacttgaaaagaaatgtgaacaatatggaggtatgtgctcggagagctacctatttcagcaccacatgaaatcgagagctttgaacgcttgtacctttcttgttttttgtttttttttaacaattcaacagcaaacatacttgtcataatggctacaataattttgtaattgacaacttttcggtatcattgaagataagtaagatataaagtatcaaaagagaagtaggaagacgctttgccctacaaaattccaaagcgaattgtgcatttattagagttaaaatgctccaaaaagctaccgtatccccagaaaaaaaccaatattagaagtaatattcctccaggactacacgccgttgttaacaatgctggaataactggaaagcacattgctgatgatttcttagatataaatgagtatctgaaagttgctaatatcaatttgtggggaccaatacgtacaacaatggcagttaagaaacttctcaaaaaagcgaggtagatcttgatttttttaaagccttaaagtattcacattttttttctacagaggtcgtgtggttactgtagccagtatttgtgctcgtgtgggtcttccaggcctcggtccgtattcggtgtccaagtacggagtatctgcatattgtgacgtcattcgacaggagcttcgaccatttggaatatctgttcatgttttggaaccaggattcttcaatacaccattaattaatagagaaaagattgatgtaggttttggaaaactttcaaaatttttttttgctatacagctatatatattttaatgctatacagttagtgttttcacaattttctgcaatttctgtagatcaaacgtagagccgataggtagtgttttaggtttagagctttaaaatatttaatctggttatgactgagttctctggaaattaaaaaaaattaagcgttttcaagaacaatgaaatttcaggcagaaattcttgaagcctggaaacatgctccaaatgaagttaagcaagaatacggggaaaagttcttcaatgatggtgagttgtacatagaaaatcgttttttttatgtacgaaaaaaaactgtgaaaataaaatgaagatttatcacaaatatactaattttaatgaaatcataaataaagttttctccaaaacagaaataaattatcgaaaaataggggtattttacgaaaaaatggcaccttctaaaagtacagtaacccattttgcaacttaaattagttttccactacttttttatctcacaaaacacatttttgtgtagcaactatttcaattcaaacacattttgcgaaagt