Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55A12.5   

sjj_F55A12.5RNAiJA:F55A12.5
PCR_productsjj_F55A12.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55A12.5 Source_evidenceePCR939WS150 Sequence/Annotation Release
Overlaps_Gene F55A12.5 Source_evidenceePCR939WS150 Sequence/Annotation Release
Chunk_score Abs_score813
Max_abs_score813F55A12.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI53464805347677
Overlaps_transcriptF55A12.5 Source_evidenceePCR939WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55A12.51198gttcccgatttgagtcctgaacatgaaatcgaggagatacatatgcagcagtgggctgatcgagttgttattggtgagaattttaaataaaatgtattaaaataaattattaaataatttcagagtgctcaattcatcttgccaagtttacaaactacagaatcgaccttgcttttgtaatattttcagatttattcgtctaattttcaagtgaataagctgtctttttttcagaacattgacagtatcgttgatgatttggtgttagctagcggtcgatttcagttcgtaaaatcttcgattttcgagtaagaatttcaaaagaattctgcaattttcttgcattcttcagagctgcccgtgatattgtatcaagtgaacaaatggacctcaacgcgataatcactccagaatcgaaattcagtttatcaaatcttggcgatgagcagacgctgaggcttcttctgtggctttatttatttcagaaatcaatgttgaaaagtgaatttctttcatcgcttttctcaaatcttccatcaactttgaatgcacaggagtatatgaaaagtgcagaatgctcaatgttggatgtcaaagtgagtgataaaattcaatatttcttctaaaactcaaaataatttttcattttttcagctttacatcgtaacattatctacagttgcctcaactacaacagaatctggaatgacaatgaaatcagctccagttgttgcttcacaattatctctcacgaagcgtcagaaagattgttggaaagcaattgttgatgcttgtgctgggtttgttcttttctttgatttcaaattctcaccggtccgaaggcattccagaaaaaccgtcgctgctctttcacgccttcgcacttcacaactcgtcgaggcggttcgtttaatttcagactcatcggaagatgttcaagtattgttcgaagcgtggaagcactgtcttcaaccatcagctgctcacgatgataatgttcatgaggcaattcaagttgtcactgaaaaatatagaaccaaaatcaatagtcttctttgttatgggtaagattaaaaaatgaaattactctgaaattacgttttaatatttcagcccgttctactcaacagctccagtatcttccatgaagcaaagtacagtaacccgtcgagatatgaaagctctctttccattgcca