Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55C10.2   

sjj_F55C10.2 RNAi JA:F55C10.2
Simmer:F55C10.2:Repeat_a
Simmer:F55C10.2:Screen
PCR_productsjj_F55C10.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55C10.2 Source_evidenceePCR848WS150 Sequence/Annotation Release
Overlaps_Gene (11)
Overlaps_transcriptF55C10.2 Source_evidenceePCR875WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55C10.21018ttgcattctctgttgttgccgttctttcggtatgcattactcttccaatggttcataactatgttcaccatgtcaagagaaccatgaatcaagaggttcaattctgccgtgtaagtttgtttctttttgcattttgatcacaataattccgtctgatgattcatttttgttgtttagggatccgccaaggatatctggactgaggtcaatgagctcaagagcatccaacacgccaacagaaccgcccgtcaagctggatacgatgctggagtcaatggaggatctgcttccgctggaggatgtgatgcttgctgcttgccaggagctgctggaccagccggaacaccaggaaagccaggacgtccaggaaagccaggagcaccaggacttccaggaaacccaggacgcccaccacagcaaccatgtgacccaatcactccaccaccatgccaaccatgcccacaaggaccacctgggccaccaggaccaccaggaccatctggagatgctggaggcaacggaaacccaggatccccaggacaagatggacagccaggagctccaggaaacaagggaccttctggaccaaatggaaacccaggagctccaggagcaccaggacaaccaggacaagatgctccatccgagccaattactccaggagctccaggaccacaaggaaccccaggaccacaaggaccaccaggacagccaggacaaccaggacacgatggacaaccaggagctccaggaccaaagggaccaaatggaaatccaggacaaccaggagccgatggaaatccaggagcaccaggacaatctggaaccccaggaggagtcggagagaagggaatctgtccaaagtattgtgctatcgatggaggagttttcttcgaggatggaactcgtcgttaagcaaattaattttcaaacaaataaatcattttcatttcaaaatatgttcgtcgtttgaaaactttataatatcccaattacttgttggatcgtttctggcaat