Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55C10.3   

sjj_F55C10.3 RNAi JA:F55C10.3
Simmer:F55C10.3:Repeat_a
Simmer:F55C10.3:Screen
PCR_productsjj_F55C10.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55C10.3 Source_evidenceePCR801WS150 Sequence/Annotation Release
Overlaps_Gene (9)
Overlaps_transcriptF55C10.3 Source_evidenceePCR801WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55C10.3977tttgttttgaacataggtggaggagagtagtgtgatgtaaaatatgagttgaaatgaaagttgtttattcgattgaataaggtttgaattaacgacgagttccgtcctcgaagaagactcctccatcgatagcacaatactttggacagattcccttctctccgactcctcctggggttccagattgtcctggtgctcctggatttccatcggctcctggttgtcctggatttccatttggtccctttggtcctggagctcctggttgtccatcgtgtcctggttgtcctggctgtcctggcggtccttgtggtcctggggttccttgtggtcctggagctcctggagtaattggctcggatggagcatcttgtcctggttgtcctggtgctcctggagctcctgggtttccatttggtccagaaggtcccttgtttcctggagctcctggctgtccatcttgtcctggggatcctgggtttccgttgcctccagcatctccagatggtcctggtggtcctggtggcccaggtggtccttgtgggcatggttggcatggtggtggagtgattgggtcacatggttgctgtggtgggtgtcctgggtttcctggaagtcctggtgctcctggctttcctggacgtcctggctttcctggtgttccggctggtccagcagctcctggcaagcagcaagcatcacatcctccagtagaggcagatcctccattgactccagcatcgtatcctgattgacgggcggttctgttggcgtgttggatgctcttgagctcattgacctcagtccagatatccttggcggatccctaaacaacaaaaatgaatcatcagacggaattattgtgatcaaaatgcaaaaagaaacaaacttacacggcagaattgaacctcttgattcatggttctcttgacatggtgaacatagttatgaaccattggaagagtaatgcataccga