Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55F10.2   

sjj_F55F10.2 RNAi JA:F55F10.2
Simmer:F55F10.2
PCR_productsjj_F55F10.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55F10.1 Source_evidenceePCR1174WS150 Sequence/Annotation Release
Overlaps_Gene F55F10.1 (3)
Overlaps_transcriptF55F10.1 Source_evidenceePCR1174WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55F10.21174ccttctcgtcggagaaactggagtcggaaagacgtctgttgtccaggcggtcgctgacctgatcggagtcacgttggacgtggtgaatgtgagcccgacgtctgattcggatgagctcattcaaggatacaagccaactacgatcggcaggctgatggagccattcaccaagttctacatggaagttttcaccaaaaactttgactcaaaaaacaatcaaaaattcattgacaatttggaaaagtgtctttcctcgggaagattcaaggattatctgagcctcgttgaagcaacagccagcaaagctcttcaaagaaaaggacaaaaggatgaacgatgggctgaactactcgtgagatctcgtcagatcagagatggattggaaaagggagctgcaccgtttgctcttcaaaagggagcagtgctggaagctgctgaaaaaggacattggcttcttgtagatgagatcaacttggcacctccagagtgtctagatgcaattgttcatgctttatcggctcctggaactcatccgaacttccgactctttgcgtgtatgaatccagcgacggatgctggaaaacgacgacttccaccaggagttcgtaccagattcacagagtttttcgtctctgaaactgcggatccacatcaactttcgctaattgtttctgcatatcttccaaccgtatctcagcaatttgttgagaatcttgtcaaattctacctctctgcaaagcagctctatccatccagttactcacttcgtacactctgccgagcactacttttcaccgctgacaacatgttcggaagtgtagatcaatcgatttacgaggctgtttcaatggctttcctgacgaatttagagagtgaggagaagaaggtgatgacggtgaagattcaggcagcgtttcgattcaaagtcggagttatgccagttcccaagcatccggagaattatgtgaagattggtggatactacgtggaaaagggcacccaactgacggaaagcgatccgaaatacgtcatcactaaaacagtcaaaggaaatttatctgaaatcgcgagaattgtgtgtagtggccggtttccgatccttctcgaaggtgagacctctgccggaaaaacgtcgattgtgtgtcacctgtcaaaggctactggaaaccggatt