Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55F8.1   

sjj_F55F8.1RNAiJA:F55F8.1
PCR_productsjj_F55F8.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F55F8.1 Source_evidenceePCR750WS150 Sequence/Annotation Release
Chunk_score Abs_score645
Max_abs_score645F55F8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI56632365664413
Overlaps_transcript F55F8.1.1 Source_evidenceePCR750WS150 Sequence/Annotation Release
F55F8.1.2 Source_evidenceePCR750WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55F8.11178aggagtgcctacatcgcatctgcccttggcggtgtcaaacttgcaaaaggagacaatggagaaaatataattgtcgaagcaactgcatggcttctgatatatcaactgaaattctatccaaacgaaatttcatatgtttctggattatgggaacgagtaaggaaatctaaaaatctttacgatattaagatttttttaactttagaaataatgttttttggaaaatcagaaagtttagaaatcgaagaactctacctttttgaatgtgcaagatgaattaaagtgattgagttgctggaacttttctgagaaattgataagaaaaccattgaaaatattaaattaatatttttaggaattcaaaaataaaatggatgagtataagaagcaagcgaaatacatttctataacatattttcactctcaaacactttccgatgaattgaatagaaatgcggaaagattggcaccaaagtaagttaaaaagcgtgttcttttaaatctattgattttttacttttcagattcattggagcatttgtaatcttagtatgcttctcggtattatgctcaattgtaacaatcaaaggatctggatacatcgactgggttgtcacaaaacctatcctttcagttttaggttagatttctacagtagggcacaaagtttatcttcattttcaggagtatcaaatgctggcatgggtattgccagtgcaatgggaatgctgacatatttggaaattcaatacaatgatattattgctgttatgccatttcttgtagttgccgttggaaccgacaatatgtttttgatggtcgctagtttaaaacggactgatagaaatttgaagtatgatcaacggattgccgagtgtatggctgatgcagctgtatctattttaattactgcactcacaggttcgatatataagtttccaaaaaaaaatctgaaattttataaacaaggataaccgaaaaaaatttaagcgtaagaaattatgtagccactcagccctggtatgtatatctcaaatatacaattgtttttcagatgcactctcattcggtgtcggaacaatcacaacaattccagctgttcagatcttttgtatttatacaatgtgtgctcttctgctcacatttgcctatcaactgacatttttctgcgcgattct