Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55G1.3   

sjj_F55G1.3RNAiSimmer:F55G1.3
PCR_productsjj_F55G1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55G1.3 Source_evidenceePCR372WS150 Sequence/Annotation Release
Overlaps_Gene (7)
Overlaps_transcriptF55G1.3 Source_evidenceePCR372WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55G1.31137cccctgttatctctagcctcattgtttgtctgcgacacagagtctctgtgtctcaaatttacatgcatcggtgcattcggagtgttgtgtgcactctgaaatgtgtccctgcaggaagctccgcccatccaccgcagtttttacttaaatatctgccgctccgaccatttcctcatacttgattcaagtccattctcatcatgccaccaaagccatccgccaagggagccaagaaggccgctaagaccgtcgttgccaagccaaaggacggaaagaagagacgccatgcccgcaaggaatcgtactccgtctacatctaccgtgttctcaagcaagttcacccagacaccggagtctcctcaaaggccatgtctatcatgaactccttcgtcaatgatgtcttcgaacgcatcgcctcggaagcttctcgtctcgctcactacaacaagcgttctaccatctcttctcgcgaaattcaaaccgctgttcgtttgattcttccaggagagcttgccaagcacgccgtgtctgagggaaccaaggccgtcaccaagtacacctccagcaagtaagccattggctgaaaactaaccaaccgaacccaacggccctctttagggccacaaatattgaaatccttacaaaactacatgttcgttaataaattatatgcactcttatatattcacgtcttttatattaggtcttttcttgaaatcttaatctagtattacgttttcctagccttcgaaggaattcaagagttcgaacttatcattcataaaaatgcgttcaatctaatcaatctaaataaaataaatctcgtctgtttaatgaggaaactcaaatttaattaaggtggaatttcacatttcaaatgtcgcagaggaaatcgatcggtgaccgaagaagcttagagaaggtaacatgaaaatgtctatattcacggaaatttaaagtttgtgtcacaaaaataataaaggcaacaaactaattaaacaacaaattttagaccatgtaccaagaaatttagtttcaataatcttcagaacacggtgactgctctggtgaatttccaagcgataatttgttcaggcaaaggaacacattaaacgtcggaataatgatggtgattgt