Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F55G1.3   

sjj_F55G1.3RNAiSimmer:F55G1.3
PCR_productsjj_F55G1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55G1.3 Source_evidenceePCR372WS150 Sequence/Annotation Release
Overlaps_Gene F55G1.3 Source_evidenceePCR372WS150 Sequence/Annotation Release
Chunk_score Abs_score330
Max_abs_score330F55G1.3
Specificity_index0.394
Rel_score1
Map_statusUnique_ePCRIV74863297487465
F54E12.4 Chunk_score Abs_score118
Specificity_index0.141
F08G2.1 Chunk_scoreAbs_score59
F17E9.9 Chunk_score Abs_score74
Specificity_index0.088
H02I12.6 Chunk_score Abs_score118
Specificity_index0.141
Rel_score0.358
F35H10.11 Chunk_score Abs_score74
Specificity_index0.088
Rel_score0.224
B0035.8 Chunk_score Abs_score124
Specificity_index0.148
Rel_score0.376
Overlaps_transcriptF55G1.3 Source_evidenceePCR372WS150 Sequence/Annotation Release
WB_DNA_textsjj_F55G1.31137cccctgttatctctagcctcattgtttgtctgcgacacagagtctctgtgtctcaaatttacatgcatcggtgcattcggagtgttgtgtgcactctgaaatgtgtccctgcaggaagctccgcccatccaccgcagtttttacttaaatatctgccgctccgaccatttcctcatacttgattcaagtccattctcatcatgccaccaaagccatccgccaagggagccaagaaggccgctaagaccgtcgttgccaagccaaaggacggaaagaagagacgccatgcccgcaaggaatcgtactccgtctacatctaccgtgttctcaagcaagttcacccagacaccggagtctcctcaaaggccatgtctatcatgaactccttcgtcaatgatgtcttcgaacgcatcgcctcggaagcttctcgtctcgctcactacaacaagcgttctaccatctcttctcgcgaaattcaaaccgctgttcgtttgattcttccaggagagcttgccaagcacgccgtgtctgagggaaccaaggccgtcaccaagtacacctccagcaagtaagccattggctgaaaactaaccaaccgaacccaacggccctctttagggccacaaatattgaaatccttacaaaactacatgttcgttaataaattatatgcactcttatatattcacgtcttttatattaggtcttttcttgaaatcttaatctagtattacgttttcctagccttcgaaggaattcaagagttcgaacttatcattcataaaaatgcgttcaatctaatcaatctaaataaaataaatctcgtctgtttaatgaggaaactcaaatttaattaaggtggaatttcacatttcaaatgtcgcagaggaaatcgatcggtgaccgaagaagcttagagaaggtaacatgaaaatgtctatattcacggaaatttaaagtttgtgtcacaaaaataataaaggcaacaaactaattaaacaacaaattttagaccatgtaccaagaaatttagtttcaataatcttcagaacacggtgactgctctggtgaatttccaagcgataatttgttcaggcaaaggaacacattaaacgtcggaataatgatggtgattgt