Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56B3.2   

sjj_F56B3.2 RNAi JA:F56B3.2
[cgc5655]:F56B3.2
Simmer:F56B3.2
PCR_productsjj_F56B3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F56B3.2a Source_evidenceePCR803WS150 Sequence/Annotation Release
F56B3.2b Source_evidenceePCR624WS150 Sequence/Annotation Release
Overlaps_Gene F56B3.2 Source_evidenceePCR848WS150 Sequence/Annotation Release
Chunk_score Abs_score785
Max_abs_score785F56B3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV765296766989
Overlaps_transcript F56B3.2a Source_evidenceePCR803WS150 Sequence/Annotation Release
F56B3.2b Source_evidenceePCR848WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56B3.21694gcttacaaacctaccgcctatttgccccatctcccttaccttcatacaacttgtgtcctttgacaaattctcactctcacagtccctcgaacacgattgagatggatttttcaatggattcgtgagcacatcaactgctgggtggaaattttgttgacattgacactgtcccttcatgcattccattccctctccaccaccacattgagcattcgatgtgcacgctgagttgagttgcccacgtggcatacagtgatagtcgacgtagagagcatttggagccatcgcattgcatggacgacggcagcaagcggcttgggagaaacttccgtctgaatttgcattgcaaataaaattttggattttattgaaattacctgacaaaaagtaacagtaatgggaatcagatgggcatttgagagctggagctgcatctggatcacaagaatatctggtgtccgtggtagtgtttaatgggcagatcacggggcagcagtgccctgaaaagttgtgttttttgtttttattaaaacatttgaaattccgccgaaaagtgggaaaaaaatggaaagttataaattccctactatttttttgttggaacatttagaattttaatttttcgaaaaaatttctcaaaagttaatatttaaaattccagtcaaattttttagttaaacagaaaatagaatttcctgtcaaaacttatttaagatttaaagtttgaattggtgccaaaaattttcaaacaattcagatttgaatatcttgccaaataaattataaaagtttaaaaaatgattcggccaaaaacagaagaaaattgaattgcatacctctttattcttttaaaaataatttcaatttttcgcttaaaatgtagaaaaatcaaaatttaaaaagtttgaattggaattctcaccaaaaaattaaggcattttattaattttattgccaaaacttctcgaaaaatctgaatttcaaaccagaaatttgcgagaaatcttttcgaaaaagcatttaagctcccacctaagttcaaaaaataatgaattcgattttccgccaagatagtttttcggatacataaaacttgaattttcgcaaaaatttatttttttctcagtgactacaaactacagagaatactaattaagtactgttaaaaaccaaccaacttgactctccccagcagtaatacaaacttgacccattggacaattgtcttgatttgaaggaatgttaaaggcgagtgatggatcggattttcgaacacagctctgtcctggaagctttccgaatggacaattggcagcagctacgcatcgagagccctgaaaaatatttcatttgaattcaaataacttattagaatttaaataaattataccatttgaatagttccagtgatgcagacgcattgcgaattgacacatgctgagaatggagaagtacaatcataatgtctggaacaacgatctccgactcgagaagttgtaatgcattctccatttgacactcgtgttgttccacgttgcacacactggcattcaccgttacggcagaaaaggggctcgcggcatttggaggagcaacgggctccgatttttgcgggtactggaagaattgtttggtcatgtttgtaataaatattcattatttttcaatcagtgtaaggtttaaagtggccaaaa