Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56B3.9   

sjj_F56B3.9RNAiJA:F56B3.9
PCR_productsjj_F56B3.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56B3.9 Source_evidenceePCR324WS150 Sequence/Annotation Release
Overlaps_Gene F56B3.9 Source_evidenceePCR422WS150 Sequence/Annotation Release
Chunk_score Abs_score380
Specificity_index0.434
Rel_score0.768
Map_statusUnique_ePCRIV771505772535
T08G5.7 Chunk_score Abs_score495
Max_abs_score495T08G5.7
Specificity_index0.566
Rel_score1
Overlaps_transcriptF56B3.9 Source_evidenceePCR422WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56B3.91031cataatgcgagtgaggctgaagttgatcaattccgaattcagagaaaagaaggtaaatccttgacgacaaaaggcagtggagcgtggaagtgtcccgtatgcgaactagttattccaacagagaaaggcttgaagaaccatatgaaccagaagcacaggaagaagcccatcgatccttcgacaatcactcttgctacaacgtcgcccacaatggtctcgcctcctcccaaggtattctatctgaaaatttaaagcattaaatataagtaattacgtttcaattatgacaatttgatcagtttcagaacaattttttcagagaatccagctacccaaatcgacggaaaaatcgcttgtttcttcagtagctacagttcgagcccaaccaactcagaaaccaggaggaaggtacaaatgccctgtggaaaactgtactttcttcaagacaaggaaggaattagcgcttcatttctcagaaaaacatgatcctggatctgagctggaaactatgagcttcgaaacggaaactgagttcaaagtaattttgcaattttccggccagtaattttagattttttttgaagatttggctcacctgtcgacaagaagagacgtgtagtagcatgcagatctctctcagctctcacgatggaaaccgcatcacccattttcgcctctgcagacacgaaggatcttatcaatctcgagcaaaagtcaaaaatgttggcgaatcgaagaagaagacgggagataatgtgtgcccagcattcattcgaactgaaaaacacgcgttaacaggagaaatcggtgtcgttggttatttcagtcactatgggcattcacttgagcatgctcggagagctctaagtgatactgagactgagtatctgattgggtaaaaaattttcaaaaaaaaaacagtttgatttcactttttcagactcatgaaagaaggtttcaataatagacagatcatcagaaaactggatcagaaatatgatgagaatagcagacttggcttcgttctttcg