Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56C11.2   

sjj_F56C11.2RNAiJA:F56C11.2
PCR_productsjj_F56C11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56C11.2 Source_evidenceePCR740WS150 Sequence/Annotation Release
Overlaps_Gene F56C11.2 Source_evidenceePCR740WS150 Sequence/Annotation Release
Chunk_score Abs_score658
Max_abs_score658F56C11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI163195164238
Overlaps_transcriptF56C11.2 Source_evidenceePCR740WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56C11.21044aacgcatacatcccaaggagcaccataatgcacgctacacgccccttcacggagcacacgaagctcgagtacttggagagccacgtgtcggctcgggaaatttttggctccgtctcattggcgatggatttgtaatctgggtcgttgcagaggaatacaattggagctaggatcgtataggtgaagatgtagtcgaggagcaaggcgagcgaggcagttaggcagaacaaggacatctggaagaagagttttattcaagctagcccacgttttcaaaaactgggctacgtgccaaaaaaggttacctgaggcgttggcgtcaagaatccgattccaaaagcaataatattggtaagtgaggtgattgtaatcgatggtccaacatcgacaatcacttgttccaaacggcgaggtctgaaaattgcaatttcacgatgcttttacaatacccctacagtacttttgcagtttctctacagcacccctgtacaactacggtacttttatttatttatatatttgttcatcaggcaacaatcataatgatacaattacaacaaggcagtgaacttttacaatacaatgccccaccctctttttccgtgaaaacttacgtgtcagtaattgcaatatgatgtttccatctgtgaagtagaataaaagcatcatcaactccaattccaagtaccaaaaacggcgtaacacattgaatagagaacgacgggaagcccatccaacaaattgctccaaacgaggcgacagttgcagccatcggagtgagcaatgatgtggcaaccagatagaatgccattttgacagatgacaggcggacaatgacaatgatgacctgagtcagaagtaggaagaatccgattgtcattagagtggtagcttcaatggctcctcgaatcatttcacgatttgctacttggtcactgaagatggtgaactgaacgtgctcgaaggcagaggagtttttggaaagttggaagagctcgtcgattgcgtcctgggaaaagtataattaggaaatgccgagtgctt