Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56F3.4   

sjj_F56F3.4 RNAi JA:F56F3.4
[cgc5655]:F56F3.4
PCR_productsjj_F56F3.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56F3.4 Source_evidenceePCR827WS150 Sequence/Annotation Release
Overlaps_Gene F56F3.4 Source_evidenceePCR827WS150 Sequence/Annotation Release
Chunk_score Abs_score722
Max_abs_score722F56F3.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII44688294470448
Overlaps_transcriptF56F3.4 Source_evidenceePCR827WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56F3.41620attgccaattgacctatcgcaataattagtacatgtgttaactcttctttcggtgatatttatgtgataatgaaagaactccgccacttttcaatttaattctctcaatgtggcatagaaacagaaaaatattaaactcaattttttttaaagaattcacgtaaaacaattttttaaaacattcacgtttacggtaaaaagttgtatttaaaaacaatcgatttcactttttctgtcattcccaagtttgttcggataatcgataaaccagatcatcaaagcatatcatggatccatcaagtgaaaacaattcgccaatggtatctccaaacgatgataaaattgtgaaaattactgtaagcagtgtgatgcaaggagttaaacaggtatgtattcgcgaaatttgagtgaaaagaatcagctctttttatagattgtggtggaaatgaaagataaagaaacagttagcattctcaaaaatcgaattgaacaagaaaccgaggttttgaccaatcgacaggttttgcttttcaaaggaatggagctcaaggataataacaaaacaatgactgattgtggaattaattctgatgcaaaaatcacgatgaatgttaaaatgagcacaggaattgttacgtaagtgaacccaaaaaaggacacaaaaaatgctgataataatgtctgaatttcagcaatcctactacaactgacattttactcatgatgccaccaattttcccaactaaccaagaccaactgagaaaggagatcaaaggaatgcatacggtacatcgtaaaccaaagaagatgagtggcatagatgcaaatgcaagtctttggacaccggagaagcaaatggaaaatgagttcactagaaatcgaatgaaaactttgcttcgccgtaagaaacacgcaccaatcttgtctggaacaccggttgattctgaaatcggatctgcgcaaacgtgagtttttggaatgtttctctgaaataccgtgaaacgcttgaatattcaaaaagcagttttatacaaagtaattccagattctcgccggttgcaactcctcccggagagttgtcttcgccgtctacagtttcatctcatgtcagctctggaagtgaaccggaaagtgatgccgaggttgttaccgaaaaagaactcaaggtaatatgccagttaagcagcagacatttggcggcattatccagaaggtgtgcgcctttaacatgtacagtaacccgctcaagttattttactattttcaaacactcaaatgtgtgaaagtattttttaaattttcgggaggactaatcaagttagaaattgcatattttcccaaaaataacgaggagtgggttactgtactttttaaagacgcgcacttatttttttctgcttcgattaaaaatttctgaaaagtttattagtggcaagagttttgcgtgaaaaatatgaaatctacgaagatttattttattatattacagctcttcttcgatccacctgaaacaattgaggaacacaaacaatgccgccgttcgatggttcttgctccgagcagcgaagaagaattgcttgagaacttgaaaaaattcgaagcggagagaaagaccaagtg