Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56F4.5   

sjj_F56F4.5RNAiJA:F56F4.5
PCR_productsjj_F56F4.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56F4.5 Source_evidenceePCR955WS150 Sequence/Annotation Release
Overlaps_Gene F56F4.5 Source_evidenceePCR955WS150 Sequence/Annotation Release
Chunk_score Abs_score829
Max_abs_score829F56F4.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI61350766136526
Overlaps_transcriptF56F4.5 Source_evidenceePCR955WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56F4.51451ggagattctgctcttgaccgtgcagatcgtaatttataaaacaattcgttaatagtcaaagttccagtgcatctcgtgacaagccggtgactcattggctcgaccatgcagctccagaacattctcaaaagatgattgactcaactcgtggactcctgaatgtcgctgttatcttctgtcctctcattttcttctgggctctttttgatcaacaaggatccacgtgggtacttcaagctcgtcgtcttgacggaagagtcggacatttctccattcttcctgaacaaattcacgcaattaatccagtctgtgtcctgatccttgttccaattttcgaaggatgggtctatccagcattgagaaagatcaccagggtcacacctctcagaaaaatggcagttggaggtcttttgactgcattttcatttgctattgctggagttttacaggtgtttatgaacaggctttgattttatataaattatgagtttcagctaaaagttaatgaaactatggagttcccaccttcccttggacgaatttatctgcaacgtgttggaaacgaaagcttgatcagtgacttcagatataaaagtgatggaagacttattggaggtaactaatattttcaaagtgttctcctttctgaaaatatcatggacccccggagtgacgtcactcctcctctgctatcattcttttctgtcttgtcaataaagacacttttaattgccctctaggcgcctctgtgccgtgccgtcgatagctcagttggtagagcggaggactgtagagttcgcagatatccttaggtcactggttcgaatccggttcgacggatttttttccatttttcagacggaatgcttccaaaaggccgaaccgagttggacgcaggaatatatacgtttaacacaggacttaaaaatgaatctcaagaaattgacatttccactccaaataaaggttatgtgatggcagttttcagattaaaagatgctgtgtaagttacttcagggaaatttcgatcgaaatcttagataatttcagagaagtagtgaagttcgactataaagttgagaaaacagataatggagcaacgcgtgtgtttgttgtcactgctcgtgaagatgctgacacattggtctatgcaatcaataagaagttagcgacttctcatactaaagatactattttactaacatatttcaggggtaaaatattgagcagttgtgagcttaaatccggatcctacgttgatgtgattcctggaatcatcagtgatccaaatgtccggttatattggggacctaagaatagttgttcaggagttgactgccctaatactgttacattgaatgtatgctgaattgtggaaaaaaggaaacgacaaatgattttttcaggcccaaatgggagccgtccatgtcctccacattcacccttcaaca