Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56G4.3   

sjj_F56G4.3 RNAi JA:F56G4.3
PF:GL1_1A6
PCR_productsjj_F56G4.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56G4.3 Source_evidenceePCR750WS150 Sequence/Annotation Release
Overlaps_Gene F56G4.3 Source_evidenceePCR750WS150 Sequence/Annotation Release
Chunk_score Abs_score708
Max_abs_score708F56G4.3
Specificity_index0.5
Map_statusUnique_ePCRI1135791511358982
F56G4.2 Chunk_score Abs_score708
Max_abs_score708F56G4.2
Specificity_index0.5
Rel_score1
Overlaps_transcriptF56G4.3 Source_evidenceePCR750WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56G4.31068tacaatagccgcattaggggagcttttgtagaaaatcaatttttacagggtaaatcctgatagttgtttattgagaaaccaggctttttgttaaaagctcgatcatgtgtactggcagccaatcgaaaggctggtgtaaggtagacatgaatacctaaagtattaaatattggtagcaatatagtttttgacaatgaagcatttattcatttagcggaagtagaaaaacaaacaattataaattaatcaacaacaattctgatttgtttcttttcgtcaagaacagagacttcgatttcctttccatcctctcttttcattgtggtagcgtcgttttcgattctgaaattaataaattgaaattaaaatattaaaacaaattctaagttcttaattctaaattctcaagtcaacttactctccgaatccatctaatcctgcaataacctccgtcaacttgaatccgcttccttgtggaacattgatggagatgtagaagattctttcaaattccttattcttccacaatttgataaactcgttgatatccttatttgtgaatttacaatcataaagaattacagagcaagcagtgaaatccttgagagtgtcaatagtcatccagtgagctccgtggaagaagatcatgttggtattctttgggattccgggaaggaactcatttggtttgaaagcttcggttggattgatgagacacttgaagttggcagagaccttcttgaagaatgaagccgagtacagcttctcagcaaccttatcgacgtcgtcatgttccttatcgacgtttccgatggtgaagttggcaatgttgagattcttctcattggcccagtcaatgatccttccagcatggttctcctgtccaagagtaacagattcaaactctccgagcccaagggtgtagatgaagtgctcggcaaccttcatgacagcaaaagtccgatcttctttttcagttgttggccagaaaatgttgatagtcttctcattctcatcaagttcaacttgaaccttcttatctccgaattcacgaactcccatttttcc