Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F56H1.4   

sjj_F56H1.4 RNAi JA:F56H1.4
Simmer:F56H1.4:Screen_A
Simmer:F56H1.4:Screen_B
PF:GL1_4E9
PCR_productsjj_F56H1.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F56H1.4 Source_evidenceePCR1031WS150 Sequence/Annotation Release
Chunk_score Abs_score968
Max_abs_score968F56H1.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI57423905743588
Overlaps_transcript F56H1.4.2 Source_evidenceePCR1029WS150 Sequence/Annotation Release
F56H1.4.1 Source_evidenceePCR1031WS150 Sequence/Annotation Release
WB_DNA_textsjj_F56H1.41199gaccagaacgaagaagagcgggatcgagcacatcgatacggttcgttgcagcaatgaccttaaattcatatttacagcttataccgtcttaaaaatataacttaaaatggaactcagcttaccttgatatcatcatttggttggaagccatcaagttgattaagaagttccaacatggtacgttgcacttcacgatctccagctttctctgaatcgaatcgcttcgtaccaatggcatccaactcatcaatgaaaataatagctggagccttttccttagcaagagcaaaagcatcacgaacaagcttggctccatctccaatgaacatctgaacaagttgtgggcctgcgagcttcaagaatgttgatttagtttgggcagcaaccgcacgggccatcatcgttttaccagttcctgaaaaacgaataatttacacttgagctgttgtaattaaaatggttattttctaggagtactactttatcaaaaatttttcgtaatcttacctggtggtccatacatgagcacaccctttggaggatgaatacccaaattaacaaatcgatccttgtgagtcattggaagcacaacagcttcaatcagctcctgaatttgcttgtcacatcctccgatatcggaatattgttcagttggccgttcgtcaacttccatagccttcacacgagaatcatattctgctggtaatttttcaagaatcaaatatgaatccttattgacaccaacgagatctcctggcttcaactcatctggatcgacaagtccaacaactggtaagaaatatgtggcacgagtggaagtcttaatgactgcgcacttggttttttgggcatcgagatcaacatttgcgccttcttcttctgtattatcctcgagatcaagaagttcgacaacgttggacaccaagtacggaagagttttgttaactttgatacgttcagtattctccttgatccgttctttgagagtggttgcagaatgattgatacgttgaacttcacttctcataatacgaatctcgttgtccaacaagtgggtacggcttttgagatcttccgtcgacattttcagaatctcctcatcaatagcatcctccacctccattgcctctgggttttttccgtcttttggcggtggtgtttgcgacattgtactgcttctggggcctgaaaattagttg