Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F57B10.7   

sjj_F57B10.7RNAiJA:F57B10.7
PCR_productsjj_F57B10.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF57B10.7 Source_evidenceePCR736WS150 Sequence/Annotation Release
Overlaps_Gene F57B10.7 Source_evidenceePCR736WS150 Sequence/Annotation Release
Chunk_score Abs_score673
Max_abs_score673F57B10.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI65567536557715
Overlaps_transcriptF57B10.7 Source_evidenceePCR736WS150 Sequence/Annotation Release
WB_DNA_textsjj_F57B10.7963ttgacaccgatggtctacgaatattacatgagcacaggagatttggattttgtaatggaaattcttccaacccttgacaaagaatacgagttttggattaaaaatcgacaggaatggttcaaagacaaagatggtgtcaagcagtttccatattatcaatataaggctaaactcaaagtaccgagaccagaatcatatcgtgaggattcggaattagcagagcatctgcaaactgaagcggagaaaattcaaatgtggagtgagatagcgtcggctgccgagacgggatgggatttctccactcgatggttttctcaaaatggagatacaatgcatcgaatggattctataaggtatcgagggtgttggttttttggttaaaaaaaaatctttttttgttaattttctatacttttttttccgattttttggttttctggattaatcgaaaaagaaaacagagaatttctgtgacatgctgtctttacaaattcaaaaattacagttccgaggttttaattctaaatcaaattcagaacgtggagcattatcccagccgatttaaacgctttcatgtgtgcaaatgctcgaattctggcgagtctttatgaaattgctggtgatttcaaaaaagtgaaagtatttgaacaacgatacacttgggcaaaacgggaaatgcgtgaattacattggaatgaaacagatggtatttggtatgattatgatatcgaattgaaaactcattcaaatcaatattatgtatcaaatgctgttcctttgtatgcaaaatgttatgatgatgatgatgatattccacatcgtgttcatgattatttagaggttagtgtcactctaaaaaaaacgtatatattgggaattttcagcgccaaggactattgaaatacacaaaaggtcttccaacatctcttgcaatgagtagtacgcagcaatgggataaggaaa