Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F57B10.8   

sjj_F57B10.8 RNAi JA:F57B10.8
Simmer:F57B10.8:Screen_A
Simmer:F57B10.8:Screen_B
PCR_productsjj_F57B10.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF57B10.8 Source_evidenceePCR713WS150 Sequence/Annotation Release
Overlaps_Gene F57B10.8 Source_evidenceePCR713WS150 Sequence/Annotation Release
Chunk_score Abs_score610
Max_abs_score610F57B10.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI65485556550192
T10E9.9 Source_evidenceePCR37WS150 Sequence/Annotation Release
Overlaps_transcript T10E9.9 Source_evidenceePCR37WS150 Sequence/Annotation Release
F57B10.8 Source_evidenceePCR713WS150 Sequence/Annotation Release
WB_DNA_textsjj_F57B10.81638tgaagataacaatgatgacgtgctagagatcaagcgtctgcatgagctcaaacggagttggtggacgagaagagacatttggaagaattcaaaagaaggaactacatttttaaacattggaaaaaggtttgtgtgatcatggaggagaattatggtcacgcttttatatttaaaaaagttttcaatagggcaacaaaaacagtgaaaaagtaacaataaaagtaacaatgagaaaaaagatttaattttatttgaagatcatattcatcaattcgctactctctgtgttaacatgttttgatctttccttcttcaccttcacaaccttcttctgctggacatctcgctggaatttatcccactttccaccggaagctgtaacctttgcttcaagctttctcaaatgttttcctttctcaatttgttcttcaaagtgagcagcaattcgacgagccttgaaaagaagaatattaatgcaaagtggccaataccgggggttactgtacctgtgcgacttccacattcattcgtcgtttttccacttctttttcatattgtaattgttccataagatgtacccatttgaaactagaaaaataaaaattcatgtatattttcatgaataacttacccagataaatatctaatattccataacatgctcgacactggatccttattctttccaccaatcggagtgttatcaatttgttcagcaattgcttttgcaatctttttctttttcaactccatccatccttctgaatatagatattgcggatttttcgagtgcttgttacgctaaaaatataatttttatgatttcatttgaaaaaaaaataagctaccgcaaggaagattcgaccaacttgtccagggcatcgcttttcaaagtattcacgcattcgaaccacgttgtattttggaggaattgttgagaagaagacaacctgaaaattacttttttttatctgtggcctctaaaatagtctaaaattatattttatcaacaatccgagaagggatcttttgaagttaactaatccttctgaagaattacttaaaattttctaacattctgattgtgagcagaatattttttgtttttttaaacaaaattaatttttaaaagcgaaaaaaacctggaaaattcttttaacctgtcggtaactcaaaactcataaattttcattaaaattaggaaaaaattggtatttttttgcgctttagactcggaataaattctatacagaaaaacgacactcagaattgtaactgtgcaaagtgtttctatttaaaaaatgcaaaaatgttcgttataagctctgcttaaaaaaaacgatttttcatgtttccttttcgattaaaaaatgtttcgcttttttttattttttcaattacgaaaaaaacgttttttttctaggattcaaccctaattctcaggtattttcgaataaaaaagttaaaaaaaaacttacaccagtcttcttttgtttttgttctggatcctcaaaagtctccatttcatcatcttctgattcttctgttttaatttcagaatcgtccagatttccagcttcatcttcattattatctgtttcaatgctttcctcttttggttcaagcatttctgaaaat