Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F57B9.10   

sjj_F57B9.10 RNAi JA:F57B9.10
Simmer:F57B9.10
PCR_productsjj_F57B9.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF57B9.10a Source_evidenceePCR980WS150 Sequence/Annotation Release
Overlaps_Gene F57B9.10 Source_evidenceePCR980WS150 Sequence/Annotation Release
Chunk_score Abs_score875
Max_abs_score875F57B9.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII69596466960825
Overlaps_transcript F57B9.10b.1 Source_evidenceePCR980WS150 Sequence/Annotation Release
F57B9.10a Source_evidenceePCR980WS150 Sequence/Annotation Release
F57B9.10b.2 Source_evidenceePCR980WS150 Sequence/Annotation Release
WB_DNA_textsjj_F57B9.101180tggctcaataatacggcacagatctttttcaagcattcgttcactcaaagaatggaaatgttttcggacaactggatccatttgaagttcctgtgggaaagaaccgaatgcaacttggaaatccttaagagatctcttttgtgcagctgcggcgatcgccttcatcgcatccaaatcagaaccattgtatttaagagcaagttttgcggacagaagactgttcacctcatctggaaggtcaagcatcacctgaaaaatttaatataggatttaaatataatagtaattatttttgagtattaccttgcacagaagcatatacttaagagcggtgagggcggacactttttcatcaaccgaatcgtatccctcaaatgcttcgtaaaagtatgagaaagctgtcttgaagtccttctcgtcggcagcgtgaagaattcccgattgaagatcgagagctgcttgcatgcgaggattcacatagattgcgttggcagttgtacgagcaccagtgagagaagcacgagcacgaccaatattggaaagattatagtacgctttgctttcctcaagttcgacttccacgagaacgtccttatcgtcgacttttttcagttcacgaatcaaatcggcagctgaaaagtagattatcagttattttcaaatattacagcgaaatatattaccaagtggaagagcctgagtgtatctttgaagatcattatagaggcgaacaagacgagcagtgagtgtttgacggaggaaagtgcgattttgctcggtggcccattgaatacattctttaacgagtccaacctgaaaatagttgggtttatatttgaagcttattattctgctcaccttaatatctccatcttgatcatcaattttaagacatagatcaacaagatctctgacaagttttgcagcctttgcctttcccaatgacaccaaaaatggcctcgtttgttcaatcatatttcggagctcttcagtttgcttattttgagccaaaatatttcccaattccatgatcgaatcttctttcttcttgatatcatcgtccccagatgctggtgattttacttcaatttgggacaaattggaaaattctgaaatatggaaaaggactcaccgagattggtgaggtgacgaatgacgttttggtcgttttgatgtggaa