Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F57G8.6   

sjj_F57G8.6RNAiJA:F57G8.6
PCR_productsjj_F57G8.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF57G8.6 Source_evidenceePCR989WS150 Sequence/Annotation Release
Overlaps_Gene F57G8.6 Source_evidenceePCR989WS150 Sequence/Annotation Release
Chunk_score Abs_score882
Max_abs_score882F57G8.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1634497316346628
Overlaps_transcriptF57G8.6 Source_evidenceePCR989WS150 Sequence/Annotation Release
WB_DNA_textsjj_F57G8.61656gttgttgctgcgtctctaagtttttatcttatctctaaagtacagacaaaagactttttgaattctgggtgttttttgcattgatttttacaccctagattaaaaagaaatgacaaattgtttgatttgtggtgctaaaaacacacgtggcaatcattttggagttcggtgttgcagagcatgtgcggtttttttcaggtgagcatattctgaccaaaaatgttccaaaatgtagtagagtctttaattccagaagaagagccggaaccaagtatttacggctgaaatgctcctccgaaaattgtggtaatcgtttctgtaagccgtgtcggctgaaacggtgctttgctgcaggaatgacaattgaacgtaaaattttatttttcttcaaataaaacttctcaaaatgagatttttctccaattttcagatttccagcacaatagagaccttatcaaatccacgatagttccaaaaatccctcgttcatttgcaaatgttgtgggccgcccgagttttgtgatcttctgtgttccccaggaatcttatcggaaaacttttgtggatctcaatgtcttgatagaaaaagctggagaaatatttgaaaaaggtccggaaaatccgtatattggctcgacgcagctcaaaaagttggcggcagcttcgaatttcacgatggactggaatcgacgatcgtttgagccgttgagtcacggagaaatgtcgtatttctgggagttttatttcttgagaaccgcgaaatggttgacgtactttgaagaatttaaaaagattccaagagatctaatggccagtttttcgatttttaaagctaaaaaattggaattcttaagctcatttttccccactttataagcttcgtaaaactgatacaaaaatttgtttcaacggatttttaaataacttttaaattcaaaggtttttagggattgctaagcattctagaatctttttggaatttttcatcttatcgaaaaaaaaacaatcttttaaaattattgaaattgacggaaaatcaattttagactgctctctttttagttaaaagtgctttacatcttcttactttttttgggcctattcaaaaacttctattttaacgtacaggttttattcaaaagttcaaaattccagatcaagctacttctatcattttggcacgttttttcaagacttgacaagttgatcacaacggcaagagctcgtaaattgaaagtttgctcacagcagacatgggcgatgagcaatggatttattctagattttgacaaaaccaaagtcgatttttggaaacttagcaattaccctgcaaaagatctattttagtaaggtttagcgggcaacccgggtcacaaaaggcgttcaatttgcccgatgttgccctatccccttgttccctcatatatcactaagctagttcagtttcctaaactcaatggctgcgttggacctacaaccacaagtacaggagctacaagagcttgaagtatcagatgtggaattcaactttatgctggcacaactcactttttcgtatgcaggaaaacggcttcaaggagatattttgaagatttgtgaaaaatttcaagaagtcttgtcaaatgatttgcatgagcattatgtgaaggaacttgg