Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F59A2.1   

sjj_F59A2.1 RNAi JA:F59A2.1
Simmer:F59A2.1
PF:GL1_6B2
PCR_productsjj_F59A2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF59A2.1a Source_evidenceePCR953WS150 Sequence/Annotation Release
Overlaps_Gene F59A2.1 Source_evidenceePCR973WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII34031503404269
Overlaps_transcript F59A2.1b.1 Source_evidenceePCR966WS150 Sequence/Annotation Release
F59A2.1b.2 Source_evidenceePCR973WS150 Sequence/Annotation Release
F59A2.1a Source_evidenceePCR966WS150 Sequence/Annotation Release
F59A2.1b.3 Source_evidenceePCR966WS150 Sequence/Annotation Release
WB_DNA_textsjj_F59A2.11120cgcataacaactctccacgacttcttgtccttgttgtagagaaccttcagctcgccggttcctcgctccttccattccttcgtctcgttggcataaatgtagagttttgaacgattgcagaacatggtttgctctccttcttctccagttttcacctcgacaagatctggcagtggaatgactggcttgaactcgccctctggctcgtaatcctcatcatgttcttcgtcttcatcatctttagctgctggaaccacgactggggaagcagtttcaggctttttaccgaagattgaagtagctggattggtcccgccgaatgagaatccggtggtggctggctttggaacaactgcaggcgttggagtagagaatgttggcttagcaggtggaattacaacttctggtggagatgtctgaaaaatattgaatttttaattgctggaactaaaacccgaaaatttgttacctttggtgcaataactccagaagctggaactgtcgattttgcttgtgctgtagtggcgaccagtggctgtgtaacgggaatagctggcttcgcagcattgagcaaattagccataacttggctttgggcctgtgcttgggcttgagcttgagcgtgagcatgagcttgagcttgtgctgcctgcacatgagccatctccatttgtcgctgaagaatcaacatttgctgttgttgctgaagctgctgtggaggaatcattgagccgagaggattcgcatcacgagcaagaagagtgtgtataatttgatgaagtctctcgagctcttttccgtgattagtgctcaaatcggacaactgcttctgaaaccgatcctcggatcgacgaatatcatcgcgaagctgggtgacgccggtctggtgctcaatctgtgaaaaataagtattaaattgagtttttcatgaatcgcataccttcaacgagtccatgcttttgataagcgagtcaaactgcattgtcatcaactgctgcacatccacgacgctggcgacaatgcgccccatattctgaaataccgtgaatcatgttgagcaacattcgaaaagattcacttaccggcttctgatcgctcattgcgaaaggagagctgaaat