Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F59F5.2   

sjj_F59F5.2 RNAi (5)
PCR_productsjj_F59F5.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F59F5.2 Source_evidenceePCR540WS150 Sequence/Annotation Release
F59F5.8 Source_evidenceePCR268WS150 Sequence/Annotation Release
Overlaps_Gene F59F5.2 Source_evidenceePCR698WS150 Sequence/Annotation Release
Chunk_score Abs_score614
Max_abs_score614F59F5.2
Specificity_index0.731
Rel_score1
Map_statusBest_ePCRX1053350310535052
F59F5.8 Source_evidenceePCR268WS150 Sequence/Annotation Release
Chunk_score Abs_score226
Specificity_index0.269
Rel_score0.368
Map_statusBottom50_percentile_ePCRX1053350310535052
Overlaps_transcript F59F5.2 Source_evidenceePCR698WS150 Sequence/Annotation Release
F59F5.8 Source_evidenceePCR268WS150 Sequence/Annotation Release
WB_DNA_textsjj_F59F5.21550aatttgggtttgattcagcgtgggcatgatcggcatgtgaaactgaactatttaataatacttaccgtggttacgcgataaagagtctgtactcttaacaaaaatttgagtttgattgaatttgatatttgataagcttgtagcgactcttcaccttttccgcccgctactcgcaaataatgcattttttccaggtaaactcgttcaaaatgtttggttatgttgttgttaatgaacaaaattcaattgtttttcttgatgggaatgaagaattcaaggtatgtggaaaatttaaactgatcatgtttgaataaaacgcacttcagactatttttcaaagcttaattcaatctgaaattacaagcagaaaatctgacctagattctgcatcaagtggagttggaagttctacgtgtacagaaggtgagtggatagcattcaattgtcagtgccaatatgatttttcagaacaagaatcatcgttagatcacttcaagaagcctaatgttgtatttaattcatctgaaatttcacatattcttctccccttaatacttctgtacaggtcgacgagtgaaaaaacaaaagatcccatcactgagatgtcttcacaatttggaacaatatcaatttcaaagttttatcacaattatctagtgttggtgtttgccaatgagtgagttttcaaaaaatatttactctcaaatgttaacatttcagcgatcgcaagcgaatcgaagtctctcaaacaatcgaacatacaatagcgacgttatttggtccattaattgctttttgtcacactgatctcacgaccgtaaagaaaccgaaagagcatcttgcctgtgcattgacgcgaaaattgtcatacagcccaaaatgttagttttgattatggtttacactactagtagtttattgtgtatcaacaaaactgaatacgcttgttttgtaattttctgcactagaaagacgttggtagcagaataaagttcaaatgtcgttggtcacaaagaaaaactaactattttaaggatttggtttagtacttattcgctttttgcgttaataacgggttttctgtttcagcattcattgatatccgacgaaaattattttacttcgacaaaatagccaagttgaaggatacgtttcataaaatttcttctcaattgaacgtgtttgttgacaacaataggtaattttttcttgtgtttattgaataaaaaaaacaatgtttttcagatgtctgttactttctaagggtgacatcattgctacttacaactctgttgaaggtaacgatgacgttttgaaagggctcaacacaaacgatctactaaacattgtatcaaacacgtcgaaatgtgatgcaaacactaagattgagcaggtttgcatagtttgtacactttcctttataacacgttctctgattcagttttggcttcgatcaacgacaggcctaattccatattatgtcaatgttatcagtgcgacagttttcaaaaacatgacattagtctgtctcgtggaatcgtcagaaaaca