Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H02I12.8   

sjj_H02I12.8 RNAi Simmer:H02I12.8
PF:GL1_4F8
PF:GL1_8D2
PCR_productsjj_H02I12.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH02I12.8 Source_evidenceePCR943WS150 Sequence/Annotation Release
Overlaps_Gene H02I12.8 Source_evidenceePCR943WS150 Sequence/Annotation Release
Chunk_score Abs_score817
Max_abs_score817H02I12.8
Specificity_index0.705
Rel_score1
Map_statusUnique_ePCRIV1140394911405074
Y17G9B.3 Chunk_score Abs_score90
Specificity_index0.078
Rel_score0.11
Y62E10A.15 Chunk_score Abs_score114
Specificity_index0.098
Rel_score0.14
C01F6.3 Chunk_score Abs_score138
Specificity_index0.119
Rel_score0.169
Overlaps_transcriptH02I12.8 Source_evidenceePCR943WS150 Sequence/Annotation Release
WB_DNA_textsjj_H02I12.81126gtcatcatccccgctgtacttctcgctatggcgactgtgatcgcttggcttctctacaaacatttgagaatgcgtcaagttttgaaggtcagattgcaaaatgcattcaaagataactcaaataaatttccagcacctcaatcagccacgatcatatccaatcgttggtcacggactcatcaccaagcccgatccagagggattcatgaaccaagtgattggaatgggatatttgtatccagatccacggatgtgtcttctctggattggcccatttccatgtctgatgctctactctgccgatcttgttgaaccaattttctcatcgacgaaacatctgaacaaagggttcgcatacgttttgctcgagccatggcttggaatcagtattttgacgagccaaaaggaacaatggcgtccaaaacgaaaactattgacaccaacattccattatgatattctcaaggattttttgccgatttttaacgagcaatcaaagattttggttcagaaattgtgttgcctcggagcagagtaagaattttaattgataactcgttcaaatgtttcttttcagtgaagaagttgatgttctctccgttataaccctttgcactcttgacatcatttgcgaaacctctatggggaaagctattggtgctcaactcgcggaggttgggtaaacaactcgaatctcaaaatttctaaatactttttcagaataacgagtatgtatgggcggtgcacacaatcaataaactgatttcaaaaagaacaaataatccgttgatgtggaattcatttatttataatttgtacggtagttttatcattaataaggtgaattaatttgtaattttcagaacagaggacggacggactcatgaaaaatgtcttcgtattctccatgatttcacaaagaaagtgattgtcgagagaaaggaagctctacaggagaatgattataagatggaaggtcgtctcgcatttttggatcttcttctcgaaatggtgaaaagtggacaaatggacgaaacagatgttcaagcagaagttgacacatttatgtttgagggtcacgatacaacatctacaggattaatgtgggcaattcatcttctgggaa