Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H04M03.4   

sjj_H04M03.4 RNAi (6)
PCR_productsjj_H04M03.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene H04M03.4 Source_evidenceePCR730WS150 Sequence/Annotation Release
Chunk_score Abs_score646
Max_abs_score646H04M03.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV58875025888668
Overlaps_transcript H04M03.4.2 Source_evidenceePCR730WS150 Sequence/Annotation Release
H04M03.4.1 Source_evidenceePCR730WS150 Sequence/Annotation Release
WB_DNA_textsjj_H04M03.41167cttattttacagccacaagacggaactaccccagacaactttgaagaatgggttctccaacactttggaccaacaattcttaacactttcttcaaaccatacactaagaaagtatggactgttgagccattaaaaatgtctccaaattgggttggatctcgtgttgctaagcttccacaggagaagctcgaggagctttgctcaatggatcaagcagagttggctaatgctgattttggatggggaccaaattcctatttcactttcccaacttatggaggaactggaaatgtttggaattcgatggcaaagaagttgccaaatgagtggttcaagttcaacaataaggtaagcgtatactgttttttgcgtgaagtgaattttctttgagttttagtttatttgctggaccgtgcatttaaactataaaaaatccatttccaggtcaccggagtcgatcacaaggagaagaccgttgagattcttgaaaagggacaaaccgagccaaccaagatgtcatatgatgttcttcttaacactgctccaattgatcaacttgtgaacaacacacaaatcactgctccattggatattgttcataataaggtttggattttttagagttttgtaaagaaaatcagaattagcagttgggttgatcaaacttggattggtcctttaaaatgtatttaacagcaatgtgaaaatgcaaaaataacattttgagacaaaagaacatttatttattttcatctcaagcattcaacacgatgttccgaaagaacaacatgttatttattagttcgatgaaacagtgaaaacaatttccaggtgttcattgtgggagttggactccgcaagccaatgacctcattcctcgagaaattcacatggctctacttcccagatcgtgaagttccattcttccgtgtcacaattctcagcagatacggagaagtgactccagatggtgataagtattggtctgtcatgtgcgagtgtgctcggccaatcgatgatccggttagtattgtaatttttatcaatacagttcattaaattcgaacaaattttcattctgatctaaaaaatgtggaacagcaaattaaaatgaattagttttatagatcaccgaggaagagatggtcaagaagacacttgatggac