Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H06O01.4   

sjj_H06O01.4RNAiJA:H06O01.4
PCR_productsjj_H06O01.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH06O01.4 Source_evidenceePCR681WS150 Sequence/Annotation Release
Overlaps_Gene H06O01.4 Source_evidenceePCR681WS150 Sequence/Annotation Release
Chunk_score Abs_score597
Max_abs_score597H06O01.4
Specificity_index0.613
Rel_score1
Map_statusUnique_ePCRI70029117004069
M05B5.1 Chunk_score Abs_score377
Specificity_index0.387
Rel_score0.631
Overlaps_transcriptH06O01.4 Source_evidenceePCR681WS150 Sequence/Annotation Release
WB_DNA_textsjj_H06O01.41159ctcatttccattctcgttcagacattaaagtttgagctttaaatagaaaagcgccgcacggatggcatacgtgaagaagatgctcattgtgaagactccagcacgttgatcacgcatctttctgaacaagtcatcacaatcgggagttttcccatctaacacttgttctatgatgattgaagtgagcactacagtagctgagcgatctagaccaaggtcacacattacaatcactgggggctgctttccaactgttggtgagctttcctgaaagaaaattcttgtttacaataattatttgaaatagttaccaaccttgacaggagctcgaaccaacgcgagcactttcttcacatcatcagggtagctcttccatggccacgtggtgcaattgtagactttggcaaatgttgcctcactacatccatctgcgacaacttccactgtatatttgttcatccagtttttgcatagttgatctacgtctacagctctagtgttgatcagccaaccttccagattcaagtagtgatttgtcgacagagggaaaaatgaatgatggagattattgactttttgaaatcgaccaatcacgaagcgagaaactcgctcgttctttccccacactatggacgcctcgtacctgaggccccacggaaaggggagcagaacgaaaaggggatcagcaaaaaggggatctgcgaaaaggggatctgcgaaaaggggagcaacgaaaaggggaactggcactgtgccaaaggcaatctatcccatgctcacatttcccatgcacacatttcccatgctgacactttcccccgtgcgtacaaaattcccatgcttacgcccagtagttggagtactcccatgcctacaactcatttttctccttttttttcgttcccatgctgatattctcatacatacattttctcccgtgcatacaaaatattctgatgcttacgctcagtagtcgaagtactcccatgcatacacctcatttattccattttttcgttcccatgctgacattcccccacatacattttttcccgtgcatacaaaattcccatgcttacatccagtagtcgaacgttcccatgctgacattcccatacaaacatttgttcccatacttacaaaaatgtattcccatgcc