Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H27A22.1   

sjj_H27A22.1 RNAi JA:H27A22.1
[cgc5655]:daf-2:H27A22.1
[cgc5655]:H27A22.1
[cgc5655]:tph-1:H27A22.1
[cgc5655]:tub-1:H27A22.1
PCR_productsjj_H27A22.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH27A22.1 Source_evidenceePCR790WS150 Sequence/Annotation Release
Overlaps_Gene H27A22.1 Source_evidenceePCR790WS150 Sequence/Annotation Release
Chunk_score Abs_score708
Max_abs_score708H27A22.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1060679810607790
Overlaps_transcriptH27A22.1 Source_evidenceePCR790WS150 Sequence/Annotation Release
WB_DNA_textsjj_H27A22.1993ctttccttgctgccagaatcatcaacactccgattatgtcgggatttcacgaatacaactcgattcaaagagattctggctccaattatggttcctcgcattgttgacactaaacaacaccgacaagttggagatgtaagctcaaaaatattataaattatacgttgtttctgaaataggtattttcagtatttacaaagttttttgcataacttgggattcgctactgaatgggatgctttcactgacacaactccattagggactcgcaacttccgaaatttaattgcaacatttgatgaatcagctccacgtcgtcttgttcttgcatgtcactacgattcgaaaatcattcccggtcaagtaatgattgcggcaacagattcagctgtaccctgtgctatgatgcttgatattgctcaaacacttgctccatatatgtacaaacgagttgctcagcagattggacttcaattgattttctttgatggtgaagaagcattccgtgattggactgctactgattcactttatggatcaaggtttcttaattatagttattattatgaggtcgtagggagaacattttcaggcacttggcacagaaatgggagcaaaagtggtatccatcttcaagtagtctcaacaattttgaactcagcaaagaacttgataggattgtgagtatttatcttacgttttagtttagaacttttttttttcaggacgttctcatgctattggatctactcggagctgccaatccatcaattggaaatacgataggaatgggtgcaaacgatcttttcagccagttagctgatgtggaatcgaatctccgaacttcgggatgtcttagttctttgagaaggaatgtctttaataagcaattatcgtacaatcaagttgaagatgatcacattccatttttgaaaagaggtaattagcaagttgaatgacttattttttacattgcctatgtggtttccacaa