Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K01C8.6   

sjj_K01C8.6 RNAi JA:K01C8.6
Simmer:K01C8.6
PCR_productsjj_K01C8.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK01C8.6 Source_evidenceePCR691WS150 Sequence/Annotation Release
Overlaps_Gene K01C8.6 Source_evidenceePCR691WS150 Sequence/Annotation Release
Chunk_score Abs_score607
Max_abs_score607K01C8.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII82776098278446
Overlaps_transcriptK01C8.6 Source_evidenceePCR691WS150 Sequence/Annotation Release
WB_DNA_textsjj_K01C8.6838tatgagaatccaaaagtgatgggagatgacgtgtaactgtatccagagaaattgtgacttgcgcgacttgttgtccaagaagctgtactgtatgtgctcgaagatcttcaagtgaagaaagttttgctagttcgcgagcatccaccatatccacaattctaccatcggccatcattacaagtggttcgatccaattaagtttatcggtttcttgaagaattgatttgatagcagaaatatctttggctagaaggatggcgttatttccaacaagaactgtgttcagggatgacatcggagtttctgaattttaagaagttattatcaaagtcacccaaaattagcttactatcaaaaatctttttcagaatcttatttccgtaacttctgaactcgatattctttgatcgcaattgattttttgcaaaccacagagtccttccaggaactggtaagaattggcatacagccatcacacgaaactcttcccttaccatccaatcacgaaccaaattcgacaaggctagctctacgtcggaatactgaaaattttgggtcttaaaaaaactgttctaaacgctaaaacacaaaacctctttcgactttcccgtatgttctctcttaataagtcccggtggaatacacatgttcacagttggtgggagctccggttttaacgcagcttcaaataaacggcgtctaaaaataacatttttgagaatactctgtcatgaatgctaacttgaaatgtcgtggagttggacgtggatacttcgaagaaactgatcgcacttgtacattgactagtggtcttaacgactggtttaacatcctgaaa