Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K01C8.7   

sjj_K01C8.7 RNAi JA:K01C8.7
[cgc5659]:k01c8.7
Simmer:K01C8.7:Repeat_a
Simmer:K01C8.7:Screen
PCR_productsjj_K01C8.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK01C8.7 Source_evidenceePCR816WS150 Sequence/Annotation Release
Overlaps_Gene K01C8.7 Source_evidenceePCR816WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII82762408277274
Overlaps_transcriptK01C8.7 Source_evidenceePCR816WS150 Sequence/Annotation Release
WB_DNA_textsjj_K01C8.71035tgacgcgcaaagtttatcagtttttttcatcgcttcgtttttcagcacttttatggatattcctgtagaaaatcatgaaaattcctgatttaactaactatgagcatttgattggaggattatgtggaggtgtgacaagtacagttgtatgtcatccatttgatcttttgaaaattcgattttcaggtttgatttcaatttaattacgcataaaaattaattttcgtcattaatttcagcaaatgaaggaagttcactcaggccacaatattcaagttatgcggatgcagttcgtaagattgtccgcgtggaaggtgttcgaggattatatcaaggatggacgccaagtctgattggtgcatctctttcgtggggactctattttcagtggtataactctttgaggacaaaaatctacgaaaatttctcgacaggaagtaaactggcaaataacttgataagtggatgcatatctggctcagctatcatgtgcattactaatccaatttggctcacaaaaactcggtattaaaatgattcgagatcaaattaaatgttctgaataggatttcagactatgccttcagtatgaaaatcaacagtctaaaaagtatgcaggaatgatggattgcttgaagaaaaccgttaaacaggagggattttttggattgtatcgaggtttcgtcacgggtgtcataggaacaacacacggagcagttcaaatcgcagcatatagctggataattgataaaagatgtcaatcacaagggttacctaaagattcatttttggtaagtttcagagagaatccaagattagtttattttatttcagagtcagacggattatgttatcgcttcttcaacttccaaggttcttgccacaacaatcacattcccgtatcaagttcttcgtactagaatgcaggatcataatacagattctcgtggagtttggaaaacaacactaaaaacaatacataacgagggaatcggtggactttggaaaggatgtcttattgcaaatgttcggcaa