Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K02B12.2   

sjj_K02B12.2RNAiJA:K02B12.2
PCR_productsjj_K02B12.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK02B12.2 Source_evidenceePCR591WS150 Sequence/Annotation Release
Overlaps_Gene K02B12.2 Source_evidenceePCR591WS150 Sequence/Annotation Release
Chunk_score Abs_score549
Max_abs_score549K02B12.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI85116758512675
Overlaps_transcriptK02B12.2 Source_evidenceePCR591WS150 Sequence/Annotation Release
WB_DNA_textsjj_K02B12.21001gaagtgttctgaaaaccgaaatgatttactcagatttagcagaaatacgaagtccctgtacattttcctgtgggttttccggttcttgttccattagttcatcttcttcatcttctggttgatcttctccactatcatcttcctcatcatcccaactatccatttcaacgttatccagtggatcgtattgattctcagtttcagcaacaagactttcaattgctttatcaattttatctgaagattccataagtttcgtctcttcacgcgcaactttcttttcgatttttgcctcaatttttggtttgacttcttctgattttctctttttcgctggtgacggtttgctatgaatatcctctgcgttgtgctcatctggcatatctaatagttcgataataagtgtattccattcaattgtatcctcatcatcttttctgtattgaagataatcgatcattttcttctgaagtgcatccaatttcggaagaacccatgtgcaattcccgcatttgcttagatcggttgtagactttacatgagtagtgtaatctataatacggatatttattgggaatcttgtaaagaaaaataaaataacttacgattaactatcactagaaattcctcgattctcatttgatccacagattcatcggccataatcatttttttgttgaaaaatcagaactgttcaaaaaattggataactatcgaatgtagaaagattcaaatgactacatctatgagtgtcatgcaatggtgctcaaaaccgatcgatttgttgctctaaacctttaggaaggtccgttcttccaccatagagtctctcaatacacctgtctataattagtctctccctttcaatgtctcttatctaatccgtcgactaccatgtgcacgaaaacattctcgagagcagagattttaagggaaaagataattataatggaatccaggaaatgagtgtagttcgatatcagttgttgataacattccgg