Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K02B12.5   

sjj_K02B12.5 RNAi (5)
PCR_productsjj_K02B12.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK02B12.5 Source_evidenceePCR957WS150 Sequence/Annotation Release
Overlaps_Gene K02B12.5 Source_evidenceePCR957WS150 Sequence/Annotation Release
Chunk_score Abs_score831
Max_abs_score831K02B12.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI85250328526227
Overlaps_transcriptK02B12.5 Source_evidenceePCR957WS150 Sequence/Annotation Release
WB_DNA_textsjj_K02B12.51196taaaccaaagccattccctgatatgcacgaagagcatcttcgtcgttccgtttgaatctacaaaaataagctctaaaataaaatatttaaaataaattccacttactctaacattttctgataactcatcaaaatattgtctcttacaaattgccgatattctttcttctctttcgccattaaagtttggaaatattgatcataaagatctccgattgcttcgtagagttgacattttgataatttaggctccatttgtggattttttcgaattttgttatacttcaccagtcgataaactgtaaaataaagtaataaagatacgggagaacttcaaaaactgactaatgcaaattcttttgacagtatcctcaagctcatgagctggaaatctagcttcatgaaaaaagtaagcttctgcgagcgacttgtaagctttgtcaagacggtttgcaaggagatattgctgaaaacatatatatatattatgcatataattatattcagctggaaagtttacatgagaaagttcacataaagtctgagcttttttatcttctgatgcgtcatcgtccattaattcagcgatatctactcgttgattcacaggagcaatactacatttagtacggagcatctcgaatctcatagatttatcatttactctgaaaattccgaaaaatataataatttatgtagaataaaaaactaaccttaataatccttcagttttgtccaacaattgcattgctctcgcattatttcctatttgattttgtagctgagcttccagtgtgaactgaaaaatattgaatttaatttttcttcggaactgatttttctaactaaccagctgagcttttcgaactttcggtgctccaccaggctcactttctttaaacgatgatttgtataaatccacaagttctctagccttttttgtcaattcaattgctcgttcaatatcagttcgttcagcttctccattcaaaaataattgttgtagacaccatgcttcaacatgatacgatagttgttcctgagatcgacttccacattcttttgccaattttcggaacgagacaatgtgttgaagacatgattctctgttacctagttccgcataaatttcacttaatgtacgttcacaaagactgccttcgaagtattttcggtgttcacgtgcgagttttgaa