Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K02B2.6   

sjj_K02B2.6RNAiJA:K02B2.6
PCR_productsjj_K02B2.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK02B2.6 Source_evidenceePCR432WS150 Sequence/Annotation Release
Overlaps_Gene K02B2.6 Source_evidenceePCR432WS150 Sequence/Annotation Release
Chunk_score Abs_score348
Max_abs_score348K02B2.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV59614655962309
Overlaps_transcriptK02B2.6 Source_evidenceePCR432WS150 Sequence/Annotation Release
WB_DNA_textsjj_K02B2.6845cgctagttatttggtatcaaccgccagacgcgttccctgcgcgcaccagttgcatttctctcgcatccgatacgcgccagttgcgcatcccaccccgttttcgatttgaattactaataatttttaattctagaatcattgaaaattagttttattgaaaaacaacgaacggaaagtaacacaatggcagaatataacaaaaaaattaatcagtaaaggttgtttccttgacttatgaggcaacttaattgtctctcgacgaactttctcctggcgaatcggtttgcctgaaaaaagcaaaattaaaaaaaaaatctttctttattaagttatataactataataatttcaatattggtcattctcaacaaaaaaacttcaccaacctcttgtacttctcttcctgaacggtttttcagctggatgggatccaaaaaactcattgtggacgttcctctaggcatcgaagagctcttcaacgcgttctgaaaacatttaagatgattgatgattagtaaattttgttgaaactaacggcacatcgtgttctttccacctgtgtggttttgatattgattttgtctttaactccaagaattgctctaacgacatcgcgggagatcccttcccagaacaaataaagagcgtccattccatcgtaccaaggtggagggatcggagcaggaagaagctctgaacaatgacaagatatttattatgattttgttttacaaacatactgtctggaatatttcgatcgttgtaatctttaggtttttcgtcatacatccatgaaattctgttggaattttccattcgaacaccatgaatatcacaatcggatc