Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K02D7.4   

sjj_K02D7.4 RNAi JA:K02D7.4
Simmer:K02D7.4:Repeat_a
Simmer:K02D7.4:Screen
PCR_productsjj_K02D7.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K02D7.4 Source_evidenceePCR782WS150 Sequence/Annotation Release
Chunk_score Abs_score719
Max_abs_score719K02D7.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV315158316238
Overlaps_transcript K02D7.4.1 Source_evidenceePCR782WS150 Sequence/Annotation Release
K02D7.4.2 Source_evidenceePCR782WS150 Sequence/Annotation Release
WB_DNA_textsjj_K02D7.41081aatcgtcgagtcatccaacctgtatgtaactccaggatgtactcgttttcgattaagcgtcttctttttatgctttccaatttgatcctgtacaactgttttctgattgatatcaacattgctattagatgttcttaggcagaagtcatatgggagagtctcgaaaattgcacgggtgtctgtggtgaaggtggagagcgccgagattgtggattccacgtggcggactggttctgagtgatggtagagggaagccgttaggtgtaaggatccggatgtactgaaatgtttaattatttttaagaatgtttataacaggcgtaactatacaaagctagaaactatacatcaacctaattgtaagttgaaattacctaagacttatttttttgcctgagccccttcgctgaggctctttaatgtgggcccttagacctagacccgtaggctaaaactgttgggcctagggatcgtctaattcctacgatcaataaaaataagaggatctttcaagaactcactatgcctctgcctttgcattcgatctctgattccaaagggaaacttccgccgatgcaagaactctcatactaattgctccaacgctatcaacgtcaagagtcaatccagagagcaatggcaccgatagtcgaacgtctctaacaggaacatgaccttcaaatgccttatgcgtccttccatctgcttcccagacagtggaaagcaggtcagtacttcccttgaagatgtggtgagttggtagcttgtgaccagcaactccaattcgaacagacccttgtggagcgccggatcttgaagaagctgatccagtcacaaattgctcaaggtgctcagtgtcgatggagagctaaaatttgtattcaataaattatcctataaaataacaaaacttaaaattccctcaccgagaataaattgtgctccttccttcccttcttcatcgatagctcaaagatggatctcttaaaggatttttgcaagaattctgtgttcgcagtggagaacagttggaagtttgaagcatctgcaatctcttgccagtgaacatgagaatccgcct