Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K03A1.1   

sjj_K03A1.1RNAiSimmer:K03A1.1
PCR_productsjj_K03A1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene (9)
Overlaps_pseudogene K03A1.1 Source_evidenceePCR410WS150 Sequence/Annotation Release
Map_statusUnique_ePCRX73099287310889
WB_DNA_textsjj_K03A1.1962catgtcttgttatctttgccctctctcaattttgcccactctctcacctccccgcctttccaccgcaaccttgtataaatgtagtgtacggttctccttcttcacagtccctatcggattccaatcgaaatggctcgtaccaagcaaaccgctcgcaaatcgaccggaggaaaggctccaagaaagcagttggccaccaaggcgctcgcaagtctgccccagcctctggaggagtaaagaagccacatcgttaccgtccaggaaccgtcgctctccgtgagatcagacgttaccagaagtctactgagctcctcatccgcagagcgccattccagcgtctcgttcgtgagatcgctcaagatttcaagaccgatcttcgcttccaatcttccgctgtcatggctcttcaagaggctgccgaggcttatctcgtcggactcttcgaggacaccaacttgtgcgcaatccacgccaagcgagtcaccatcatgccaaaggacatccaattggccagacgtatccgaggagaacgtgcttaaatttctgattttcagagagtttgagaccgtgtcgattaaaaccccaccgaacccaacggccctctttagggccacatacttatgatccaattttttcaatccattttgaataaatattaagccttcattattttttaacttattgtaaacagaacaaaaccaggaatcttcagagccatacaatttttttaaaaatgttctactgtcctcacagaaagtgtcattattgacgtcaccaactgtctaatctgaatccaggtcaagtagacatttgtgacgtcactattctttgtatctatgagaaattgtttttgtatctatgagaagttttttttaattgcaaggagaggtgctactgacctcagcaaatggtgacgtcatcaattttatattcagggcaaatgagcatctataaaaacggca