Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_K03A1.6_f   

sjj_K03A1.6_fSequenceTATCGTAGGCTTTCGCAAAAATA
PCR_productsjj_K03A1.6