Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K03B8.10   

sjj_K03B8.10RNAiJA:K03B8.10
PCR_productsjj_K03B8.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26H10.1 Source_evidenceePCR840WS150 Sequence/Annotation Release
Overlaps_Gene T26H10.1 Source_evidenceePCR840WS150 Sequence/Annotation Release
Chunk_score Abs_score735
Max_abs_score735T26H10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1141982111420947
Overlaps_transcriptT26H10.1 Source_evidenceePCR840WS150 Sequence/Annotation Release
WB_DNA_textsjj_K03B8.101127tgctctttctcaacgtgtggaggcaacgatgtgcatgtgaaccatgcaagaactttggcaaatcttaaaatagaaaacaaaacattatgtagcaactcaacaaaaaaaaacttaggaagcattcacgtactttagtgctcttttggacattcgctcgccaagacttcctcgtttttgaatggcaattattacggatgagacaacggttcctagggaaatcactattatcattgctagaatgaaccatccaattagaggaataaatgtagatgttgtaggcatttgatcggagaccattaacatcaaaatggacatggaaagaagggtcgtgatacccaatgatactttctcttcacgcattcctgatgcagatgatgttctgaaaatatgaaaacatggctctttaaataattaattttttgaaatttgttaaaacttacgtgaagaatcctacaatagcaattagagtaataatcgatgttggaataataagattgactaaatagaacaacggttttctccgaagatatagcgtcaactgcagtaacgtgtagttatttggacaacatgcgtatttcacttcctgtcttttaactgaaaacgaagaaaaatattttgaaaacctcattaatgatttagtcatttaaatgctcactttttgtttgtaaaatgtaccatccttcgttttccaagtagtttgatgttccaattttatccgagtatgggaaataatctatacctttttggtcatatgtccaagatgagaaggtcattgtgcagacctaaaaacaagaacattctttattttggtctcaaaaacgaaaactaatgagtttagctgtcaacgtttacaacctaattgtacgaaaaaaaaacgtacttgtacatcaaatgggaagaaccggaggtcgagtagacatgagaacttataaattgtcggatatagaagttcgatcaatgcagctcttcgatgtgtgtcagttgtaagttttgagttcaatagtctccttgtatcgtcgtctttcattaccaatgaattgtaaagtgtggtgtctggtaaccaaatagagtcgtacggcaagcgaagctccgttatattttcgtaatcgtccggattccaatagaga