Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K04G2.2   

sjj_K04G2.2RNAiJA:K04G2.2
PCR_productsjj_K04G2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04G2.2 Source_evidenceePCR767WS150 Sequence/Annotation Release
Overlaps_Gene K04G2.2 Source_evidenceePCR1093WS150 Sequence/Annotation Release
Chunk_score Abs_score1051
Max_abs_score1051K04G2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI80312818032471
Overlaps_transcriptK04G2.2 Source_evidenceePCR1093WS150 Sequence/Annotation Release
WB_DNA_textsjj_K04G2.21191atcaggaagtcgatatggcgaattgtgtcgaaatgagaataacgagaactcggaggcgtaatcgtgtagcctgtacaatgattcgaccacttccaaattctcatttcacattgctcttctcacatggaaacgctgttgatcttggacagatgacatcatttttgtatggtcttggattccatctgaattgtaatgtattcagttatgattattccggatatggatgttcaacgggaaaaccgtcagagaagaacctttacgcagacataaccgccgcttttgagttgctaaaatcagagttcggggttccaaaagagaaaattattctttatgggcaatcaataggcaccgtgccaagtgtcgatttggcaagccgcgaggatttggcggcactcgtattacattctcctctgatgtccggaatgcgtgtcgcttttcccggaacaacgacaacatggtgttgtgacgcgtttccatcgattgagaaagtgccacgtgtcaaatgcccaacactggtgattcatggaacagacgacgaagttattgatttctcacatggtgtatctatttacgaaagatgcccgacgtcagtagaaccactctgggttccaggtacgatataagctttttgtagttttctgattcgaaatgaaatcggaaaaattgtatttaaaattggaattcttgtaaataaaatctcaaatttataggagctggtcacaatgacgtggagcttcatgcagcatatctggaacgtctccgaagtttcatcgatatggaggcttctgcgattcgtgttactgcaccaattactaacgcaacgagtaccaatagtcggacgatttcgaatggcacatcttcctagtacaacataatcaatctcttatcgttttctgtaaattctagaatctaaaagttctcatcgtttttaacgaaaggtgattgaaattggagaaacaatgtggacaatttaaatatatcgaggtgatatttgtctttttcgagttattttattaaagtttacctcccaagtttattttaatttctaatctattgagattgaatccaattttcaaacttatctcatctcccccggttaatttaaccgcgtaagcttcacctcaatcataactttccatattccaaatattatatgtctactaactttcccctacccaattcgcgtgtttt