Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K04G2.5   

sjj_K04G2.5RNAiJA:K04G2.5
PCR_productsjj_K04G2.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04G2.11 Source_evidenceePCR258WS150 Sequence/Annotation Release
Overlaps_Gene K04G2.11 Source_evidenceePCR307WS150 Sequence/Annotation Release
Chunk_score Abs_score265
Specificity_index0.385
Rel_score0.625
Map_statusTop50_percentile_ePCRI80381388040307
K04G2.5 Source_evidenceePCR487WS150 Sequence/Annotation Release
Chunk_score Abs_score424
Max_abs_score424K04G2.5
Specificity_index0.615
Rel_score1
Map_statusBest_ePCRI80381388040307
Overlaps_transcript K04G2.5.2 Source_evidenceePCR485WS150 Sequence/Annotation Release
K04G2.5.1 Source_evidenceePCR487WS150 Sequence/Annotation Release
K04G2.11 Source_evidenceePCR307WS150 Sequence/Annotation Release
WB_DNA_textsjj_K04G2.52170aattcctccaagtttctgtggatatgtgagaccagcgtaaatagcgagagctccacccattgaaaatccaccgacagcaattcgagaagctggaattccagctgcaacttccgcatcaatcaattgatgaacatattgggtagctcgattaattccttgctcatcttcctgagcatttggatcgaggccaaataagtcgaaccaagctggcattcgcattcccatattgagggttactggacgttcagagctgaaaaaagtgaatctgtttcagtggataatggagggtgtcggtttttcgattttttgtttttaccgatatttaaaaagatcgatttgaaaaatagcttgaaattttctatatttttcctcttttaagaagaaaattatgttttatctcatcaatatataaccgaaattttattaaaaaattttttttgttaattttctcttagtttttcgatacttttgtttaattctattataaatgtacttttctgctataattaataattctgcattcaaaagtacctgtgtggacagataaacttgatattatcgtgtttggcttctgtcttgaaagcatctgcccaaccatgcccttgatcaccgagtccatgaaggaagattaatgttcctttatgctcgccacgtggcgacacaatcgaaggatttccgttggagactgcagacattcttgtcgaatcttcttcgtcggatggcggtccaccaagtgaacagagaagacgggaagaaagtgatgaccctgaagttttctgtggtttttttcatgaattttagataaagaataaagaagtgaggatctttcgaaacgtagcgctctgattgtcaatgtccgcgattagtatgaaaacattaaaagaaagcaacgacacacaaaacacaaaatagtttcaacgaacctattattgaagctagaaaagtttttggtgaagaagaaaatgtggaatttgacgagaaggggtggacagtctgtgtagagacggcagaagttacaataactcgtgagaagaggcctggaaaaggggaaacaatgcattcagaatattctttgattgattaggcttatttgagagtgagaaggacatggaattattcgtgcaggtgggaacatttttgagctgtttattaaaaatttgaataagttactgtgatttcacaaaattttgacataccttcttgaaggcgcacggaattattcgtatgggtctcgcggctcgctttccctcgaaattttcaatgaaattatttttttagcgagtttgtcgctttcgtttcatttttttgtgaaaaattgttttaaatcagttaagcaagcaggtcaaaatcgtgtgaaatttcaataaccgatttgaaaacgcttctgaaatttaaaattaggttactcatttagcaggatgaaactgtagtcaataaagtttagtaaaaaaaaaacacggaaaatattagcttagtaaactgaataataataatacacaaaggggaatatgggtgatctgggaaaaacagcacggcacaaacgacaaaacctgataaaaagacgcaacggctagtggaaatggcgcttctagacacgctgcgaaacatccaattacagcgatctgacacgttctcggtgaaggtatttatgtaaaactattgaaaagatatggttaaattggaattgaaaccaaacttgtgaggaatataaaaaatagactttaaaaactgaaaagtagtcaaatactttattttacaagatggttgattcacggcaagagggaagattgatcgatgtgaaacagcttgcatgaatcgtgtattttccagttcttcacgatgtcctcggtttctctctaaaaatttttgtataaattaattttttctggaaactttcaaaacctcaaatccactgaaatcgataactccgacaacagcaacgtatggaaatttgttcataattcgagacaattcctttctcgttaacacctcgatcatcggtattcctgcgagaggacagacaatttgtagagaatggaaattcgaagcagctgaattattaaatatgtttattgccacgaaaaataaagaataaatacctcttaaattattctcgtccatatttttcgcgtagaagatgagctttactcttccagactgtgcaaacttt