Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K04G2.8   

sjj_K04G2.8 RNAi JA:K04G2.8
Simmer:K04G2.8:Screen_A
Simmer:K04G2.8:Screen_B
PCR_productsjj_K04G2.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04G2.8a Source_evidenceePCR1148WS150 Sequence/Annotation Release
Overlaps_Gene K04G2.8 (3)
Overlaps_transcript K04G2.8b.1 Source_evidenceePCR1148WS150 Sequence/Annotation Release
K04G2.8b.2 Source_evidenceePCR1148WS150 Sequence/Annotation Release
K04G2.8a Source_evidenceePCR1148WS150 Sequence/Annotation Release
WB_DNA_textsjj_K04G2.81148gaacatcatcaattgacgtctcaacagcagaacactacacattatagcagtggatcagctaacactatgactcggagtgatggtgcaactactgtgccaatggataacattattacaccaacttatgctattttgaatccaatattggtacacgaacagacaccgaacgggacagttccacgaaagacttcagaagagttggatagtcctgatgatgttctcccaggtccatctcttgaggaggaagaaggtgattatgctataataggaggtgccgcacaaaagacagatgacgagcttttgactcgttctattcaatctgaaatgcctacttcgtcgtctactccgaagatgaaagtctcgcctcgccttaatggattcttctctccaactcagaaaacaacatcgtctcctgcatggtctcatccagatacctcaccgattccaaagtcatcttctcatcgaactcaacctaatcgtcgtcaagatgcttctgatgcagatcgtcttttaatggaatcaataatgtcagagatgccaaaaagtcgaattatatctccacgacttgctggtacacaacaatatcttgaacccgagccagagagaagaagtcattcaaaaaacgaggaagccgatcgccgcgacgcattcaccgcatcgcatgagcccagcgatcataacggcattgatgtggcaagaggctcagactggtctccacaacaacaattacatcgaatggagtcattggaaagccaagctagtagtgaagatagttttggattaactgctgaagaaccaaattcatcaacttctggtgctgctgcaaacactatgagatttgacgatgagatcgatgcatctcttccaatggattgtgtcgatgatgatgattacgactatacttatgatcatttcgaagattatgaagatgaggaggatcctgatgcgactcagtttgatgatggagttgatgcacaactaactatcgattgttcaatgatttctagtggaagcggttcatcgcaaagaaatgaaactacgacaacgtcacgagattcaaaagctttagctacttccacaccaaaaggatctgcatcttcactcccaggagttcgacaagccacccgagtatcaacgaatggaaagtc