Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K04G7.12   

sjj_K04G7.12 RNAi (3)
PCR_productsjj_K04G7.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04G7.11 Source_evidenceePCR284WS150 Sequence/Annotation Release
Overlaps_Gene K04G7.11 Source_evidenceePCR338WS150 Sequence/Annotation Release
Chunk_score Abs_score296
Max_abs_score296K04G7.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII71616557162324
Overlaps_transcriptK04G7.11 Source_evidenceePCR338WS150 Sequence/Annotation Release
WB_DNA_textsjj_K04G7.12670ccttgatctgggttcttctttctctttcttttttgctcaagcttctcagtaacatctgcagacatctctaaactgcgaacacgttcatagtccaatcccttgtcttctgcagcttttcgatcttgtagctctttaacctgccattgatctctttccttttttgcttcgtggttttttggaagtttgctgcgacgatcttcttcaacgacctacaattttaaattataattgaaaatgtaaacgttaaaacactaacctgttcgtgattctcttttctcgctctttggcggagtttgtgaagatcacggaacctctgattgaaatccttcatttttgatccactggacgacggcccactgctgctcgattgtgattcggaagacatctaggaaaaagtgttgaagagaaatccagaaagttgagaagaaaagctacattgaaacggaatacagaatattttgaacatcagaaaaagaagaaccgatatgatttgaattcatttacaatctatattttttaaaccgatagttacatgttcaaaacatattaatactatccagctttgcgaaacaaagaaggctttcttagaaataagcatggtactatcgataaggagttcaaaaatggaaataaaaactttattttctagttgaaaatgctgagaatcgag