Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K07A1.1   

sjj_K07A1.1 RNAi JA:K07A1.1
PF:GL1_2G6
PCR_productsjj_K07A1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK07A1.1 Source_evidenceePCR828WS150 Sequence/Annotation Release
Overlaps_Gene K07A1.1 Source_evidenceePCR828WS150 Sequence/Annotation Release
Chunk_score Abs_score702
Max_abs_score702K07A1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI95822379583565
Overlaps_transcriptK07A1.1 Source_evidenceePCR828WS150 Sequence/Annotation Release
WB_DNA_textsjj_K07A1.11329ttttgtggcgaatgtaacgaggaatgatacttccatgattcctggaaagatgtacaaggcgtagtgatctggtttcagaaagattctaccaccaatactggcgatgtgaacgagtgtatcgagaatacagagcagcaagtagagcgattttgcttttttgttcatctaaaattaaattgatttttgaaatattaaaacgtcgtattgattatttacctggggaacgtagacatgagctgggtagacatcgcatctttgcgagctcacatccaacttcttttcgatgtttccatcagatggctcattgaaaaccagaaacataccgcgcatcatgattctagaaatgttctttaaatacaaaaatttgtcaacagaagataactatcgagtgaggatcgaactctacgaataaaaaatatatgaaaaaaaaacaaaaacgtttgatacaattttattaacggtggaaattataacaacacaacaggtaacagcatcaacaaaaacaatgagtttcaaaacttaagcaggttgcagaataactttaccatccttgaacttgtcacgaagattaaaatagaagaggtgagtgtgatagctggcaaccaatatgacacgaaggcaagtgactgaaaaccgatacatgaacaaaaatataaactcgaaagaagttcctcacataacccgaaggttaagccaaacagtgccatcgttcctctgtcgagcgatgggatgatcaacgaaaagtcttggcgggttccagatgcatcttcaaaagtttactttaatatttaaaaaaaaacagaaaataaaagctacccggtaggaatgcgatgaaagtgatcagagtcgagaaaacaagttggaatacaagataaatcatctgtacacgaagcaaccagacatgttcttttccgtacaccgacaggaacgcgacttcaataacgatctgaatttttttttgatattcagaaatgaacgacgttcacctaccaaaccaaggtatccaactttgaaaaagtatcccatgacaccgtaaattaaaatttgtgccataatagtcagtacgcaaaacattcctttctccatttttttggtgaattttggaatataaacaagagctgggaaaacatcacagttttccgtcgagacttgtagtttgcggtcgacgcactcttcgattgattcgttgacgatcaaaaactttccttttctcatgggtttacctgaaaagtggctaaaacgaaagtaaaaagaaagaaatcaagcgagttgctttggaaaaaaagtaaaaaacattcgaatttttaaggcacacggagatgtagagca