Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K07A1.11   

sjj_K07A1.11 RNAi JA:K07A1.11
Simmer:K07A1.11:Screen_A
Simmer:K07A1.11:Screen_B
PCR_productsjj_K07A1.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK07A1.11 Source_evidenceePCR969WS150 Sequence/Annotation Release
Overlaps_Gene K07A1.11 Source_evidenceePCR975WS150 Sequence/Annotation Release
Chunk_score Abs_score891
Max_abs_score891K07A1.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI96169739618109
Overlaps_transcriptK07A1.11 Source_evidenceePCR975WS150 Sequence/Annotation Release
WB_DNA_textsjj_K07A1.111137aacagtttcataatgcgggctgaacgatacttgaaatatttcgtcgttgtgatgtttcagcgtgtacatttttttgcgcatattcctcatatcccacaaagcaaccgttttatcaacagatccggttgctaaaatgtattcggaaaacggattgaaagtaatacaattaacttctgcagtatgtccgacggctgtgagctgtggctttgattgacgcagatcccataggtttctaaagacgtgaaaattattttgaaatctcgacagaatggtatgatgtatttatacttacagttttctatcatctccaacagatccaaaaacgaaattatggagcgcgtgaaaagaaacatcctccgcatttgatgaatgacctttaaacttgctttgtggcactatttgaccggaaatggtctgattcgcgtttatatcccagtggcaaatcttaaaaaatgtatatttatgtatatcttttgttagaaataccattccgtcatcgccggcagttagcaaatgtccctctctggtgttgctccacgacattccatatccttcgccttcatggcctttcaatcgcaattgaggtcgaaatttggtgtcttttggttcagatgggtgcttcgtgtagtcgaaaatataaacgtcatcagaaggacctcgacttgcaataatgaaaggattatgtggcatgtaacgtgccctatgaacttctcctggatggttgattttaatctcagtatcccattttgcagcgctgccctctccataacctccgaactcttcacgttccgaatcccatttagcgtcgtcgaattctggtgtgtctgtcgttattgtgaactttgagatcatgagatgattctgaactcctccacaagtatgtgttccatgaatcattcgatgcatcgatgaatccgagttctctgtcttaaaaaaataatgaagaaggcgaaatcatatttaccgattcttacttttgtgacatcaggcatccattgcactgataaagaaggccactcgacctcttttgtgacgactgtatcgtagagatatggaacatttttcttccaaattctatgttctttactcgtttcttcacacgattcagcttcactcattgtgctctgaaattgcctg