Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K07A1.12   

sjj_K07A1.12 RNAi JA:K07A1.12
Simmer:K07A1.12:Screen_A
Simmer:K07A1.12:Screen_B
PF:GL1_6F6
PCR_productsjj_K07A1.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K07A1.12 Source_evidenceePCR1028WS150 Sequence/Annotation Release
Chunk_score Abs_score965
Max_abs_score965K07A1.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI96185289619656
Overlaps_transcript (2)
WB_DNA_textsjj_K07A1.121129gagaaatcgctgatcttggcggtgtgcccaccgtgaataaacaacagctctggtggaccatcttccgcgtcttcggcagattggtcttctccaatcttagataggtcccacacatgaagacgtttatcagtaccgctggatgcaagaatagtctcgttgtgtggactccactgaacttggaagatttcatcacgatgtgattcaaatgagtgaagtttcattcgtagattacgtagatcccaaagagcgacagttttatcagctgatccggtggccagaatgaattcggaatatggattgaatgcgagacagttaacttcggcagaatgagcatcgatacagtgtccaggagtgcttgtgcgcacatcccaaatgagcctataatttttaattagttaataaatagaaaaaaaacaaaagcttacaatttcttatcgtcaccaaccgatccgaagacaccatcatgcaaaacgtgccaagcaacatcttcaacgactgactcgtgacctttgaaaacatccttcgcttgcaattccccggcaacattctgatttgcgttgatatcccaatgacaaactgtctgatcatctgacgctgatagaatcaaaccttctttgtttggattccatgataatccatagccttccttcgtgtgtcctttcagtctgataagcggattgaacgtgttatcacgaggaacagcagagtgctttaaatagtcgaaaatgtaaacatcagcatgtggagactttgtagcaatgatattcgacttttgaggcatgtaacgagctctgttaacctccccttcgtggttaatgcgaatatcgggttccacttttccgttaacagctccgaaaccaccgtattcactgcgctcggtatcgtagcgagatgcatcaaattgggcatcatccgttggcatacagatcttagaaataagcaagtgattctgctcatctgaagtatgagttccaagaatgagccgatgaatagtatggtcgctgttatcctaaattatttgaattcacttcatgaaagttgtgaattatatgagaacacataccttcgcaacgtctgggagccattgaacactgagtgaaggccactcaagcgcatgtgtcattacgag