Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K07A1.4   

sjj_K07A1.4RNAiJA:K07A1.4
PCR_productsjj_K07A1.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK07A1.4 Source_evidenceePCR839WS150 Sequence/Annotation Release
Overlaps_Gene K07A1.4 Source_evidenceePCR893WS150 Sequence/Annotation Release
Chunk_score Abs_score788
Max_abs_score788K07A1.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI95885359589855
Overlaps_transcriptK07A1.4 Source_evidenceePCR893WS150 Sequence/Annotation Release
WB_DNA_textsjj_K07A1.41321aataccgaaatcagccaacgtttactattgaaactcgctaaaaaaaataaattccattgtcttttgaatatatttaatacaacccaaattgctttgaaaaaagacttcaaaatgtttcccagttctttaaaaatttttatttctacaaaacaatgaaaaccattatgaaacccatctattcataagtcaaagttgctttatacgggaattctccagccaaatccttgatgtctttggaaatgttatagtggcagacaccttttccaaattcacagctcggtgtaatgttcagggtgacttcagcttcacgtttgtactcggtacagtcatggtacaagcgtattatcggttcatatccctgcaaaaagtgttttaaaattcgaaaacatgctttttttttacaaaccttcgagaactgctcatccgaacgttgccatccttccattgtgaatcgagataatcctggatgggcttttccaattttttggcttgtaatagcgtcgttgccgtttagtggccaatgatctctctcgaagatctgcacattgtagctgtagctttctctctgatgataaccacaagtgaaggagacgttgaaaatgaacttatcatcagatgaaacgacgatgatcacagttgtcaagaggagaaatacagttgttccatacattctctcgaaagacttatgtgtactgaattcaatttgaaatccaaagtctagtcgtatgagaaaataaagttcacgttaatcatttatttttgtaaagtaattaatattcggaatagtgtagttcaaaaacgaagagcgcgatttggttttctttaatcatctaccagatttgcatacatcgtaacttttcctctcatatccgtgatatctcttgaaattttgaaatgacacaagccagtaccaattggacaaagtggcttaacatacatgtaggcaccaatatcttccctatttccattacaattatgagtaaggagcattctcacatcgtaaccctggaataatttcaaatttggtttttattcagaattaaaaaaaaacctccgaagtgatctcatctccttcttgttttccaaacattgtaaaattatgacttcctggaagagcttctccgaatttcggtggagtgattatatcatctttgttaagtctgaaaactttcaaaattttaaaggaagtgcaacaaaaaacgaaaaaattgagcttacacccaaaaatccgattcaacaaattgaattttatacgaatatcttccaatatgatgaagatgacaggtcaatgaaacatcaaaaaggaatcggtccacagatg