Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K07C5.6   

sjj_K07C5.6 RNAi JA:K07C5.6
Simmer:K07C5.6
PF:GL1_7E3
PCR_productsjj_K07C5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K07C5.6 Source_evidenceePCR825WS150 Sequence/Annotation Release
Chunk_score Abs_score762
Max_abs_score762K07C5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1035747110358410
Overlaps_transcript K07C5.6.1 Source_evidenceePCR825WS150 Sequence/Annotation Release
K07C5.6.2 Source_evidenceePCR824WS150 Sequence/Annotation Release
WB_DNA_textsjj_K07C5.6940aaatggattttcgcgcatagaacgagattttggatcgtaatatggggaattttccgccaaattgtacagatacttggctgtatcttctcgaattcgtaggtttctcactgtgattctagtacgggaatccatatccaccgaaactccagccatatccgcatcttctgcatacatatcctcatcttttggagctccatcctccgttgtagctggttcaacttctccctctttcatttcatgctctctgaccacttttctagcttcttcaagatgctcatagtcttcaattacttgtttatgagtagatggatcgtatccattccaacgatctctttttgcatcaaatccaagtgttagattcggctgtacgtagtcatcttccgcgatattatcattggtttccctgaaatgaaaattgtttttttttaaatttgaaatgaacttactttgcgttagattttctaggtcggtcgaaacaatctcttttctgatgacccattgctccacagttttcacaagcccctttacgaaacttggttgccgattttcccgttgttcctttttggtaccactcgtgaatttgagtcatctttttctccctttcttcatgcggtctctgatgcttcaaagtgggtccttcactaggtacgtaccacggattttgtgagatgaacatgggaatatgtggattgatatcacgaccagtctgcacatcaaccattgcaggagcagttccagcttttcgatcttcctgaaaatcaatatttgctaatgttattttatgattagtggtttatagcacaaattattgtaaactcacttccagttgacgatcgcgctgaacttcagctttggatttcttatctgctacattgacttgctgtttaattaacgccgaaggcggtaagttctgcttataagacgccatgaagatgtctga