Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K07F5.1   

sjj_K07F5.1RNAiJA:K07F5.1
PCR_productsjj_K07F5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK07F5.1 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (26)
Overlaps_transcriptK07F5.1 Source_evidenceePCR426WS150 Sequence/Annotation Release
WB_DNA_textsjj_K07F5.11184gaagaacggatagagcaagaacaaaaggtgaaaggtggtgaaaggcgcgaataacttctgaaattcgattgcgatggcaatacaagacactcaacaacaagagcttttgaggatggaaacaatttctcggatttattgaaacggatttattggagttttcttatctagctttctatgggttctactcgattattcctccacataggtctccaaatggtcttctgtaatttatttaattaattgtcataagggacacaattttgaagattcaaaaatgtgaaaagttcaaaactaaagaaacaaggaacttttaaaactattcattgaaaaaaatcaataagggctctatgggttgtactcaattggaaggttcttgcgacgaaccataccgtctccctggaaccattcacgacggaattgcttggcagcaccatccggggtgttggtccactcaacagtgatacggtcgttgttggtatcctcttgtccaaaggcaaaagcatcgcaggaaacagcaagaagcacagcttcctttgggtcgagaactccacatggtggatcaactccaagtctcttcatgttggtggtcttgataccatatccaatacgacgagccgatgagttgatcaccttgatgtggtaggtgtgcttgtcatcgtatggcgcattgaagacgatcttggtacccggttgggtttggatgtctcctggtgggactgattgggccatggcgacttattgttggagttattaaaaactcaatgaggattatgacaaaatctgtctaatttatagcagccttcttatctttgtcccagatctttgccatagacacgtcacataaagttcaaaaagttaataaattaattcaataatttttaaaatccgtgaaagaattaaattttctgaatgatttaaataattttttaatctattgcctcacaggtctaggattcaacatatcaatttatcctgtttttcaagaaacacgcttccagtccaatggaaaacatctcaagaagacacccagtttctcgagaatcgttaaatttttttttcttcctagcaagagaaacattgtctagctctgataaaaacaatggaaatagcattgtggacgcacgggctaaagaaattgggctaacaagagaagtgtttgaaaactatccctgacatcgagatga