Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K07G5.4   

sjj_K07G5.4RNAiJA:K07G5.4
PCR_productsjj_K07G5.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK07G5.4 Source_evidenceePCR949WS150 Sequence/Annotation Release
Overlaps_Gene K07G5.4 Source_evidenceePCR949WS150 Sequence/Annotation Release
Chunk_score Abs_score824
Max_abs_score824K07G5.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI71670227168664
Overlaps_transcriptK07G5.4 Source_evidenceePCR949WS150 Sequence/Annotation Release
WB_DNA_textsjj_K07G5.41643ttcggaaatacgaggcaaacgatgttgagtggtgaaggcttggcattttctttcggcgacggactgatggaagtctgaaaattattgaaagtttataggctgaataaggggaaaagttggctttttgccttgaaggacctgactatgctcggtgatttgttcttggattctgattttaagttcggtgaataatttaaaggaccaaacgaaaagaagagcttaaaacatatttctaaaatcaaacctttgaattaatcttggctgaaatgtagtacacggcggaaactgttggaaagccataattggacgaacaggcaattgaggtctaatatcaattggtggtggagtcaaatgatctccataaatttcttcgtaaattgcaaatgacgatgaattcttgagaattgatcgtggaacactttctgttcgggttatggatggtcgaggtggaggtggcgaagcttcagatgatgaaatatcatgataatatattgtagatgtaggttctcgaatcaataatttctttttatgagatgaatttgaattaggagaactcgagcaatgtgacgtactgggaatttgttcatctacttgcatcatatcaaaaagtcgatccatttcactttccattaactgataagaaaatggaaatgaacgaaaactagaatttcgatattctcgtcttggaactatatcgagtgtaacatcatcatcatcttcatcgtcatattccattgatacttcttccaatgttgccacgtcatcctccatttcatcatgttgtggaagttcttcacttgagctttctgtcattaaatgtttgattgatgttaacttgggcatcatggggacttgacggacagaattagcacggattgtggttgattcatcctcaccttcgtagtcacaatcagcagcagtgctctgaagttaaaggaggtgtaatagaggacaacttattaatttaatatactcaaaatgatcccaaaataccgatttataatgaactactcttgaaaattatcaaaattttatgatataataatagaaagactaaactttgacaacttgagcgtgcttcagaaattatctcctttagtgctggtttagattgtaatatggttctaaatttttattaacacttgaaaacttctaactattgctgttttttaaacttcagctttgaaacagtttgcaaaatccggaaaaaatatttagaaacaattaccattgaatgtgatttgaaagttgtagagctgacggtagaggttctcgatgtaactgttcctcctttttcttttaatcttgaacgttcggtgcagtcaagctggaattaattgattattacgtttttaagagttaagatgacaaactgcataatagttggttccatttgaatatgatgagcttagaagagcagtatttggtcgaagaatgaattgagaatcagagagagcttttgaaacatcggatgatgaacagtaaccggttgaatcagagtcaccatagtaatttctagaaaatagaaattagaagatcttccgataaatattgtttatttaaaatttttgattggaacatttttgataacggattcgagaatattttacaagaagaacttactttttcctccatggtaacgc