Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K08D12.c   

sjj_K08D12.c RNAi JA:K08D12.c
Simmer:K08D12.c:Repeat_a
Simmer:K08D12.c:Screen
PCR_productsjj_K08D12.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK08D12.3b Source_evidenceePCR129WS150 Sequence/Annotation Release
Overlaps_Gene K08D12.3 Source_evidenceePCR563WS150 Sequence/Annotation Release
Chunk_score Abs_score458
Max_abs_score458K08D12.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV17102081711017
Overlaps_transcript K08D12.3a.2 Source_evidenceePCR556WS150 Sequence/Annotation Release
K08D12.3b Source_evidenceePCR376WS150 Sequence/Annotation Release
K08D12.3a.1 Source_evidenceePCR563WS150 Sequence/Annotation Release
WB_DNA_textsjj_K08D12.c810ttttgtaattcctcgcaactgataatttcttttttctaaaatcaattatttgcagtaatgtcggacagaaattgctacaagtgccaacagccgggacatatctcccgcaactgcccgaatggcgagtccgatggtggacgtagaggaggtggaggaggtggagtggtgttgaatttggggtgttgagttgatttaggtaaatacattatctcttgatttcttaccgaattgcaataatttttgaagttctggagaagtggaggcgaagagaaatgtgtttaagctggcggagattaggagttatttgatgataaatttacagcggaaatctcgagactaatttcatgttatttcaggatccacctgctacaactgccaagagactggacacttctctcgcgattgccccaagggaggatccggaggaggacaacgtggaggtggcggcggcggtggatcgtgctacaactgcggaggacgtggacactactctcgtgactgcccatccgccagatctgagggaggaagcggtggctacggaggccgcggtggagaaggcagaagcttcggcggacaaaagtgctacaattgcggacgctccgggcacatttcccgcgagtgcaccgagagtggctcggccgaggagaagcgttgctaccagtgccaggagaccggacacatctcccgcgactgcccaagccagaccaactaaatcaatcatcattccccccattttcgttgtcttttcattgttctgtaactcgaaataatgtattcaactgaaactttcgttcactcctttttccaata