Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K08E7.3   

sjj_K08E7.3RNAiPF:GL1_6E4
PCR_productsjj_K08E7.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK08E7.3 Source_evidenceePCR1054WS150 Sequence/Annotation Release
Overlaps_Gene K08E7.3 Source_evidenceePCR1054WS150 Sequence/Annotation Release
Chunk_score Abs_score991
Max_abs_score991K08E7.3
Specificity_index0.854
Rel_score1
Map_statusUnique_ePCRIV1256782812568978
F55H2.4 Chunk_score Abs_score169
Specificity_index0.146
Rel_score0.171
Overlaps_transcriptK08E7.3 Source_evidenceePCR1054WS150 Sequence/Annotation Release
WB_DNA_textsjj_K08E7.31151tgtctgccgactactcatcggagaagttcaaggcgacgcatctggtattaaaatgtttcacatttgtcttttgaaattttattctgattttcagttcgacgaaattctatggcattttcgttcaaacttatcactcaaaacgaacagaagaggattggccactgcggaaaacagtttcagcgggaaagaagctgtggattttctgatgattgaaatgccacgaatcatccctaacaatgttccggaacgagacaagatgcagaagttcctggagttcatgatggacatgaacgtgatttcagaagccttcccgaagaaagtcaagcaaaggaggccattcagtgaatcgagaatatatttgttcatgaagactttggatgagttgaagcatcccaagccccgatcacgtcgatcagcgtctttcagtggtgctcgcaaaagtgcaaagtatgccaaataatcattttaaactgtgctataaaatatatttccagagttgctcaacctgcctctcctgccgcgacaatgcaccggccaccaaaggcaaggctcccacgaagattatcgcgatctaatggcaacattgacaaagcaggcatcgataattcttcaggcggcgttgagaatcacggtttcgatgatcataaagacgatgaaatcccgaagaaacaacgaactccgaagattttgaacagatcacttgaaagtatctgtacagaagaatatactgaaaaacgagaagtttctgagatgaaagagaaggtttatgattggttaccgtttttcaaatcaagacgaaatcacacgaaagtcaatcaaccaacccgtcgttcagcatcccttgatcgaaatcattgtgttttggaacaagaaaaagctgaagctgctcttcgtagtcagaaagtaaccactccgccaattcgagaagccccgaaagacgtcgtctttatgcatccacaaggaccgttgcctgcagttcctagcagatatcaaaatcatcggacaagcatcgcaggatcaaatccagcattgttatcgcgtggaagaatgtacgaatccatcatgagaagatcgtcggttgttccagttgcagactctgtccaggcaaacaacgaatgctcattttggaaaacagagctgcttggacgatt