Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K09H9.5   

sjj_K09H9.5RNAiJA:K09H9.5
PCR_productsjj_K09H9.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK09H9.5a Source_evidenceePCR745WS150 Sequence/Annotation Release
Overlaps_Gene K09H9.5 Source_evidenceePCR745WS150 Sequence/Annotation Release
Chunk_score Abs_score663
Max_abs_score663K09H9.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI31392743140782
Overlaps_transcriptK09H9.5a Source_evidenceePCR745WS150 Sequence/Annotation Release
WB_DNA_textsjj_K09H9.51509cgtaggagtgttgtaggatggacttggaaataaatagtgacttcaccctagggttactgtaggaggattactgtagacgtaaggctcacctgtccctccaatcgatcagagtaatagtttttggttgcgtagtagactgaaaatcgccaaaacagaaaagctccgatcgcgaagactaacaatttcacaactatcaccaccaatgctttttcgaagaactcttcatgatgtccttgagagtagaagttcaggaatgattgggtgtcgaaaaaggcgatcaagagttgaataacggttaataatccccagataagaaattgagagagctgaaatagaatttagtataagtgtgtgcgcgtttttcgtttgtgtagtctgatctttggtattttggccaaattttctgactgtgagaaaatttttcagcaggaaattcgaattctaagaaaaatttcaatgagaaattcaaattttctgagaacaaatttacagggagagtcaaatttttcgagaaaattttaagaggaaaatttaaaaaaaaaagaaaaaaattgtgagctttccagcaaactcaccgtaaacaacaccattggccacatgaatcgatgcttctttttacggagagcatatattgtgactaaaatgagaacgagatggaaaccaatccacatgagccaccatgggaacaggaaaagcatgtagatggggattacaagaaatatttccaggagaagaagcactttggaagcattctggaaaaaattgggagtccctcgacaggaggcgatgcactgctttgcaaatctgcagcgcgcattttggagaaacgaactaattttaaattaaatacgcaaagcaccctattttacgcgcaaatttgaaaagtacgcagaaataggaaaaatcgcgaatttcaggcatggtgcaacaatgaaacttgactgatttcacttgctttttgaaaaatctactaattcgtgaaaacacgcaagggaccattttttacgcgcaaatttgaaaaagtacacaaatttcagacatggtgcatcaaagcaatacacttgattccacgcgcatttcaaaattttgtgataggaaaattttacataataaaaattatgcaatgcaccatattttacgcgcaaaaatttctggaaaaaataaaaactcaccacaacatggcactttccaaaaacacatcgatattttggattctcagcttgaaaatcgacataaaaattgaaaagtttcgtgaaatactctttaataggaactttatcaaagaaaagaaccatcgtgaatctgattttttttctttttttagagaatacctttcttcataacttcaacggcgtgaatttctagagaaaatcagagagtgtgcgatttgaagagtgtgcagacaagagagagagagagaattctatcaaatcatgtgtgttgggtgtggtatttagtacaacagagaaactgttttttgattcattctttgttaggggtttgcagata