Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K09H9.7   

sjj_K09H9.7RNAiJA:K09H9.7
PCR_productsjj_K09H9.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK09H9.7 Source_evidenceePCR515WS150 Sequence/Annotation Release
Overlaps_Gene K09H9.7 Source_evidenceePCR515WS150 Sequence/Annotation Release
Chunk_score Abs_score390
Max_abs_score390K09H9.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI31507403152127
Overlaps_transcriptK09H9.7 Source_evidenceePCR515WS150 Sequence/Annotation Release
WB_DNA_textsjj_K09H9.71388gagagcaaccacaagtttttgacaccaaacttctgcgtttcagtctcgctttctcgcgacagatcgcatgagaagctgatcgatcctggaaatggttttgttagaatggtgagaaggagaaactgaataataccttttttcggcttctccatcccactcgtcgaagagcttgacgtttcttcgtctgcggtgaatcaggagatgatggaggcctgcttcttctgtttcgaatcttccactgcacgtggaacaggagtatctcgtcttctcgacgtgttgtttcatatgtttgtacctgaaaaatcaataattgctcgttatgttttggatgcaaacgtcttacagatttggaattgtcacattatcggagcacttgcagcatctcacagagaacgcagagaaaataccagaaattgttgcagaattatctgaaattcaactaacatatatacaccttaatatatcaattaataaaggtataggatgtaactgccactcacgcacactgatcgatcttataagggtttattaagtaaaagggaacagacgaattgcatcgtcgatacacagtaaacgagagaaaagggaaaacgacaagtaacgggttaaagagttaagaaatgatcacaaatgagcgtcgtcctctccttatataggcattctggggttaaaggcgcagcatttaacgacgacgggtctcggcgtgacaatgcgaccttctgtagcttggcggcggtttgaactggagtttctcctcctcgtggattgccttcgctgtagaaatcgttgtcctcgaccgatttcgtccgttctttctgtaaattatcagagagaatttacaggcaaataaattagtatttatttatgtaaaatgtgaagtgaaaagggtgggaatccttacaaatttcaactgaactctctgttgcaacacattttgggattggtagctttgcattgtgcagaacgagtgctcgaatcactgattcatgaattccattctcagcgagaattttcaaattggtgaagaacgcctctgaaaaatttttatataaaaaacgcttactgcagaagttaggattcacacagaattcgttcaaaagttgaatattacattcagaattccattttcaatttaagtagaagctgcagctgtctcgaaattacttacttttggagccgatgaagtcgatccatgcattaaattttgcgacgaaagttccagaatctgcagtcgaattcattgggaatcgctggtttcctgaaacaagataaatatattttatgagtttctaaatttttgcaaaatttaatttatttaggaagagaaaaaagttcagaaaaacaccaatctgttcaaaactaaaatctgagttgatgagttgtggaaa